Incidental Mutation 'R5067:Dscr3'
ID388391
Institutional Source Beutler Lab
Gene Symbol Dscr3
Ensembl Gene ENSMUSG00000022898
Gene NameDSCR3 arrestin fold containing
SynonymsDcra
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R5067 (G1)
Quality Score218
Status Validated
Chromosome16
Chromosomal Location94497783-94526830 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 94526404 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023615] [ENSMUST00000125229]
Predicted Effect probably benign
Transcript: ENSMUST00000023615
SMART Domains Protein: ENSMUSP00000023615
Gene: ENSMUSG00000022898

DomainStartEndE-ValueType
Pfam:Vps26 3 283 2.5e-79 PFAM
Pfam:Arrestin_N 5 144 9.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210205
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The region of chromosome 21 between genes CBR and ERG (CBR-ERG region), which spans 2.5 Mb on 21q22.2, has been defined by analysis of patients with partial trisomy 21. It contributes significantly to the pathogenesis of many characteristics of Down syndrome, including morphological features, hypotonia, and mental retardation. The DSCR3 (Down syndrome critical region gene 3) gene is found in this region and is predictated to contain eight exons. DSCR3 is expressed in most tissues examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Dscr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02197:Dscr3 APN 16 94501690 splice site probably benign
R0644:Dscr3 UTSW 16 94502195 missense probably damaging 1.00
R1256:Dscr3 UTSW 16 94512366 missense probably damaging 1.00
R1973:Dscr3 UTSW 16 94501546 missense probably damaging 0.99
R2286:Dscr3 UTSW 16 94512253 missense possibly damaging 0.69
R3854:Dscr3 UTSW 16 94510806 missense probably benign 0.01
R3855:Dscr3 UTSW 16 94510806 missense probably benign 0.01
R7578:Dscr3 UTSW 16 94499069 missense probably damaging 0.99
R7956:Dscr3 UTSW 16 94501646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGGCGTTTGTCATCTGC -3'
(R):5'- GCTATCACTTCCGGAAACCC -3'

Sequencing Primer
(F):5'- TCTTCACCCCCAGAGCG -3'
(R):5'- TCCGAAACGCAGCCTTTCG -3'
Posted On2016-06-06