Incidental Mutation 'R5067:Syt7'
ID388395
Institutional Source Beutler Lab
Gene Symbol Syt7
Ensembl Gene ENSMUSG00000024743
Gene Namesynaptotagmin VII
Synonyms
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10389090-10453181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10442858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 382 (V382A)
Ref Sequence ENSEMBL: ENSMUSP00000127973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073899] [ENSMUST00000076968] [ENSMUST00000169121] [ENSMUST00000223586] [ENSMUST00000224135]
Predicted Effect probably benign
Transcript: ENSMUST00000073899
AA Change: V218A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073560
Gene: ENSMUSG00000024743
AA Change: V218A

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 151 254 3.29e-25 SMART
low complexity region 261 274 N/A INTRINSIC
C2 282 396 4.98e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076968
AA Change: V426A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076234
Gene: ENSMUSG00000024743
AA Change: V426A

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 195 298 3.29e-25 SMART
low complexity region 305 318 N/A INTRINSIC
C2 326 440 4.98e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169121
AA Change: V382A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127973
Gene: ENSMUSG00000024743
AA Change: V382A

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
low complexity region 104 121 N/A INTRINSIC
C2 315 418 3.29e-25 SMART
low complexity region 425 438 N/A INTRINSIC
C2 446 560 4.98e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223586
AA Change: V262A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000224135
AA Change: V333A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225861
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have no gross abnormalities or obvious neurological defects. They do develop fibrosis in the skin and skeletal muscle over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Syt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Syt7 APN 19 10443391 missense probably benign 0.03
R0412:Syt7 UTSW 19 10444080 nonsense probably null
R1068:Syt7 UTSW 19 10444011 missense probably benign 0.01
R1793:Syt7 UTSW 19 10443990 missense probably damaging 1.00
R1955:Syt7 UTSW 19 10418038 missense probably damaging 1.00
R2049:Syt7 UTSW 19 10439213 missense probably benign 0.28
R2170:Syt7 UTSW 19 10439380 missense probably damaging 1.00
R2911:Syt7 UTSW 19 10443435 missense probably benign 0.00
R3694:Syt7 UTSW 19 10435636 missense possibly damaging 0.69
R4330:Syt7 UTSW 19 10421798 missense probably damaging 1.00
R4573:Syt7 UTSW 19 10439212 nonsense probably null
R4691:Syt7 UTSW 19 10426481 missense probably damaging 0.98
R4732:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4733:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4811:Syt7 UTSW 19 10435567 missense probably damaging 0.98
R5069:Syt7 UTSW 19 10439237 missense probably benign 0.00
R5071:Syt7 UTSW 19 10443428 missense possibly damaging 0.92
R5372:Syt7 UTSW 19 10426621 missense probably damaging 1.00
R5830:Syt7 UTSW 19 10421787 missense probably damaging 1.00
R5979:Syt7 UTSW 19 10443479 missense probably damaging 1.00
R6737:Syt7 UTSW 19 10444044 missense probably damaging 1.00
R6833:Syt7 UTSW 19 10444144 missense probably damaging 1.00
R6843:Syt7 UTSW 19 10421771 missense probably damaging 1.00
R7010:Syt7 UTSW 19 10417990 missense probably benign 0.16
R7078:Syt7 UTSW 19 10435599 missense probably benign 0.14
R7206:Syt7 UTSW 19 10417973 missense probably damaging 1.00
Z1176:Syt7 UTSW 19 10443410 missense probably damaging 1.00
Z1177:Syt7 UTSW 19 10426493 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCCCTTCAGAAAGTGCTAC -3'
(R):5'- TTCAGTTAAGGGACTACAGGGG -3'

Sequencing Primer
(F):5'- GAGGTTATAAGGTCAGCCCCACTC -3'
(R):5'- ACTACAGGGGGCCTTACACTC -3'
Posted On2016-06-06