Incidental Mutation 'R0432:Clasp2'
ID38841
Institutional Source Beutler Lab
Gene Symbol Clasp2
Ensembl Gene ENSMUSG00000033392
Gene NameCLIP associating protein 2
Synonyms1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
MMRRC Submission 038634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0432 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113741473-113919682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113909419 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 423 (T423A)
Ref Sequence ENSEMBL: ENSMUSP00000150145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022]
Predicted Effect probably benign
Transcript: ENSMUST00000111838
AA Change: T1109A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: T1109A

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 877 2.03e-1 SMART
low complexity region 995 1009 N/A INTRINSIC
TOG 1043 1274 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163895
AA Change: T1130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: T1130A

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166734
AA Change: T1110A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: T1110A

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213663
AA Change: T423A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000214522
AA Change: T1127A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215022
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 99% (91/92)
MGI Phenotype PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,816 L110P probably damaging Het
4930522L14Rik A T 5: 109,736,919 C358S probably damaging Het
9330182L06Rik G T 5: 9,440,966 G659* probably null Het
Abca8b C A 11: 109,980,015 V104F possibly damaging Het
Afap1l2 T C 19: 56,917,119 probably benign Het
Ahctf1 A C 1: 179,784,161 I548R probably damaging Het
Alox12b G T 11: 69,169,556 G646V probably damaging Het
Aoah C T 13: 20,911,198 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Atxn1l A G 8: 109,731,693 W646R probably damaging Het
Cabp2 T C 19: 4,084,903 I28T possibly damaging Het
Cacna1b G A 2: 24,687,704 T719I probably damaging Het
Camk1d A T 2: 5,445,135 H70Q probably damaging Het
Car1 T C 3: 14,770,176 T170A probably benign Het
Ccdc162 T C 10: 41,541,860 T2113A probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh17 T A 4: 11,771,273 C18* probably null Het
Cdk17 A T 10: 93,237,790 probably benign Het
Chd9 T A 8: 90,994,450 probably benign Het
Chrm5 T A 2: 112,479,655 K372M possibly damaging Het
Col11a1 A G 3: 114,205,901 probably benign Het
Col27a1 T C 4: 63,225,611 M512T possibly damaging Het
Dclk3 A G 9: 111,484,935 D693G probably damaging Het
Dcun1d3 T A 7: 119,857,950 K180* probably null Het
Dmxl2 T C 9: 54,416,951 R876G probably benign Het
Dnmbp A T 19: 43,854,857 Y432* probably null Het
Eml2 C T 7: 19,179,531 Q125* probably null Het
Faap100 A C 11: 120,373,876 probably benign Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gda A G 19: 21,417,107 Y129H probably damaging Het
Gga3 G A 11: 115,590,524 R207C probably damaging Het
Glg1 T C 8: 111,182,569 I496M probably damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10322 A T 10: 59,616,208 H49L possibly damaging Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Gramd3 G A 18: 56,474,069 C85Y probably benign Het
Grhl1 C T 12: 24,582,919 P153L probably benign Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hdlbp T C 1: 93,425,332 I414V probably damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Lipe G A 7: 25,398,488 P10L probably benign Het
Lrrc8a A G 2: 30,257,067 E631G probably damaging Het
Lvrn T A 18: 46,905,299 N973K possibly damaging Het
Man2c1 T A 9: 57,135,597 H250Q probably damaging Het
Mup3 T C 4: 62,085,282 T117A probably benign Het
Myo6 A C 9: 80,273,974 probably benign Het
Nbn T A 4: 15,983,951 probably benign Het
Ncapg T A 5: 45,672,428 N157K probably damaging Het
Olfr1024 T A 2: 85,904,157 N299I probably damaging Het
Olfr1137 G A 2: 87,711,430 H159Y probably benign Het
Olfr1154 T C 2: 87,902,960 T239A probably damaging Het
Olfr1178 C T 2: 88,392,033 T262I probably damaging Het
Olfr1434 T A 19: 12,283,903 M285K probably damaging Het
P4ha1 T A 10: 59,348,257 Y180* probably null Het
Pcdhb19 T A 18: 37,499,535 F794L probably benign Het
Pdxdc1 T A 16: 13,854,400 I379F probably damaging Het
Psme3 T A 11: 101,320,442 S185T possibly damaging Het
Ptgr1 A G 4: 58,978,045 S116P probably damaging Het
Ptpn23 A T 9: 110,389,010 probably null Het
Rabgap1l A C 1: 160,722,205 I277R probably benign Het
Rapgef1 C T 2: 29,679,816 T93I possibly damaging Het
Rbp3 A T 14: 33,954,773 D226V probably damaging Het
Rnf144a A T 12: 26,339,329 C38S probably damaging Het
Rptor C T 11: 119,780,553 Q281* probably null Het
Rragd T C 4: 33,004,332 L208S probably damaging Het
Slc12a4 T C 8: 105,959,488 E41G probably damaging Het
Slc16a1 G T 3: 104,653,419 V347F probably benign Het
Slit1 G A 19: 41,743,293 T39I probably damaging Het
Sra1 T C 18: 36,677,503 N98S probably benign Het
Ssx2ip T C 3: 146,426,429 L215P probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Tep1 TTTCTTCTTCTT TTTCTTCTT 14: 50,866,823 probably benign Het
Tgfbi T C 13: 56,632,191 probably benign Het
Tmem232 T C 17: 65,256,503 M632V probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnnt3 T G 7: 142,512,086 D153E probably benign Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Tpsab1 A G 17: 25,343,824 probably benign Het
Usp34 T A 11: 23,401,505 V1431D probably damaging Het
Wdr49 G T 3: 75,450,022 R285S possibly damaging Het
Wdr7 A G 18: 63,796,249 Y1052C probably damaging Het
Zan A T 5: 137,382,316 probably benign Het
Zfp652 G A 11: 95,763,739 V323I possibly damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zfp874b A G 13: 67,481,836 S10P probably damaging Het
Zmynd19 A G 2: 24,958,122 Y110C probably benign Het
Other mutations in Clasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Clasp2 APN 9 113905992 splice site probably benign
IGL00885:Clasp2 APN 9 113911416 missense probably damaging 1.00
IGL01314:Clasp2 APN 9 113906127 missense possibly damaging 0.89
IGL01344:Clasp2 APN 9 113813292 splice site probably null
IGL01567:Clasp2 APN 9 113880096 missense probably damaging 1.00
IGL02238:Clasp2 APN 9 113880020 missense probably damaging 1.00
IGL02299:Clasp2 APN 9 113879989 missense probably damaging 1.00
IGL02323:Clasp2 APN 9 113868726 splice site probably benign
IGL02635:Clasp2 APN 9 113908842 missense probably damaging 0.98
IGL02645:Clasp2 APN 9 113890061 missense probably damaging 1.00
IGL02976:Clasp2 APN 9 113906136 missense probably damaging 1.00
IGL03190:Clasp2 APN 9 113844140 nonsense probably null
IGL03219:Clasp2 APN 9 113848477 splice site probably benign
PIT4810001:Clasp2 UTSW 9 113906067 missense probably damaging 1.00
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0421:Clasp2 UTSW 9 113854302 missense probably benign 0.02
R0458:Clasp2 UTSW 9 113906224 intron probably null
R0865:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R0972:Clasp2 UTSW 9 113847705 missense possibly damaging 0.58
R1037:Clasp2 UTSW 9 113896634 splice site probably benign
R1925:Clasp2 UTSW 9 113906197 missense possibly damaging 0.88
R2015:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R2066:Clasp2 UTSW 9 113906157 missense possibly damaging 0.86
R2330:Clasp2 UTSW 9 113876304 missense probably damaging 1.00
R2568:Clasp2 UTSW 9 113878764 missense probably benign
R3011:Clasp2 UTSW 9 113901513 missense probably damaging 1.00
R3879:Clasp2 UTSW 9 113889961 missense probably damaging 0.98
R3915:Clasp2 UTSW 9 113908737 missense probably damaging 0.99
R3928:Clasp2 UTSW 9 113906105 missense probably benign 0.28
R4323:Clasp2 UTSW 9 113889959 missense possibly damaging 0.91
R4571:Clasp2 UTSW 9 113847721 missense probably damaging 1.00
R4975:Clasp2 UTSW 9 113903916 missense probably damaging 1.00
R5445:Clasp2 UTSW 9 113903946 missense probably damaging 1.00
R5564:Clasp2 UTSW 9 113812768 critical splice donor site probably null
R5697:Clasp2 UTSW 9 113860122 missense probably benign 0.01
R5780:Clasp2 UTSW 9 113850152 missense probably damaging 0.99
R5787:Clasp2 UTSW 9 113862242 missense probably damaging 1.00
R6011:Clasp2 UTSW 9 113876247 missense probably benign 0.07
R6026:Clasp2 UTSW 9 113911578 missense probably benign 0.13
R6090:Clasp2 UTSW 9 113852735 missense probably benign 0.06
R6262:Clasp2 UTSW 9 113876352 critical splice donor site probably null
R6427:Clasp2 UTSW 9 113892444 missense probably damaging 1.00
R6464:Clasp2 UTSW 9 113773717 missense probably damaging 1.00
R6586:Clasp2 UTSW 9 113813264 missense probably damaging 1.00
R6628:Clasp2 UTSW 9 113896720 missense probably damaging 1.00
R6745:Clasp2 UTSW 9 113875270 nonsense probably null
R7032:Clasp2 UTSW 9 113854323 missense probably benign 0.04
R7165:Clasp2 UTSW 9 113786399 intron probably null
R7221:Clasp2 UTSW 9 113852757 missense probably damaging 0.99
R7336:Clasp2 UTSW 9 113876353 splice site probably null
X0022:Clasp2 UTSW 9 113852672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTATGCCTCTAGCCTCTGAAG -3'
(R):5'- GGAATATGACAGTGCCTGAACTCGC -3'

Sequencing Primer
(F):5'- ggaggtggaggcagcag -3'
(R):5'- GAATCTTGCTGGTTGATGCC -3'
Posted On2013-05-23