Incidental Mutation 'R5068:Cc2d1b'
ID388418
Institutional Source Beutler Lab
Gene Symbol Cc2d1b
Ensembl Gene ENSMUSG00000028582
Gene Namecoiled-coil and C2 domain containing 1B
SynonymsFreud2, A830039B04Rik
MMRRC Submission 042658-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R5068 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location108619940-108634123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108623464 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 27 (V27A)
Ref Sequence ENSEMBL: ENSMUSP00000030320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030320]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030320
AA Change: V27A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030320
Gene: ENSMUSG00000028582
AA Change: V27A

DomainStartEndE-ValueType
low complexity region 39 59 N/A INTRINSIC
low complexity region 90 110 N/A INTRINSIC
DM14 167 224 1.11e-20 SMART
DM14 278 335 5.07e-24 SMART
low complexity region 370 382 N/A INTRINSIC
DM14 383 441 8.62e-27 SMART
low complexity region 487 498 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
DM14 527 585 6.44e-26 SMART
coiled coil region 604 626 N/A INTRINSIC
C2 690 804 8.05e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126668
Predicted Effect probably benign
Transcript: ENSMUST00000134844
SMART Domains Protein: ENSMUSP00000123277
Gene: ENSMUSG00000028582

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
DM14 108 165 1.11e-20 SMART
DM14 200 257 5.07e-24 SMART
low complexity region 292 304 N/A INTRINSIC
DM14 305 363 8.62e-27 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
DM14 449 507 6.44e-26 SMART
coiled coil region 525 547 N/A INTRINSIC
C2 612 726 8.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193462
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,436 Y155D probably benign Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
6030468B19Rik A G 11: 117,802,875 Y56C possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Add2 T A 6: 86,107,458 L496Q probably damaging Het
Akt1s1 T C 7: 44,850,008 probably null Het
Als2 G T 1: 59,211,274 P437Q probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd17 T C 5: 90,254,808 R1464G probably damaging Het
Ankrd24 T C 10: 81,639,865 S121P possibly damaging Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Bnip3l T C 14: 66,999,632 E57G possibly damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdc37 T C 9: 21,149,803 T19A probably damaging Het
Cep152 T C 2: 125,571,816 I1199V probably benign Het
Chd6 G T 2: 160,966,369 L1642I possibly damaging Het
Chst13 T C 6: 90,309,569 E137G possibly damaging Het
Cnrip1 A G 11: 17,054,687 D79G probably damaging Het
Dars2 A T 1: 161,041,913 C589S probably benign Het
Dhx15 T G 5: 52,170,067 I102L possibly damaging Het
Dip2a A G 10: 76,318,043 L151P possibly damaging Het
Dlc1 T C 8: 36,938,030 T202A probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dlgap4 T C 2: 156,707,111 F464L probably benign Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Dthd1 C A 5: 62,818,716 D244E probably benign Het
Dtl A T 1: 191,568,373 D126E probably damaging Het
Ell2 A G 13: 75,763,618 N341S probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Erbb4 A T 1: 68,043,902 probably null Het
Erc2 A T 14: 28,302,943 H593L possibly damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fyn A G 10: 39,526,843 K204E probably damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gm4847 A T 1: 166,638,384 F212Y possibly damaging Het
Gpc5 T C 14: 115,417,264 *499R probably null Het
Hcn4 T C 9: 58,860,021 L955P unknown Het
Hook2 C A 8: 84,993,399 L111I possibly damaging Het
Hook3 C T 8: 26,095,757 probably null Het
Hvcn1 T C 5: 122,233,481 F28S probably damaging Het
Igkv6-32 A G 6: 70,074,283 F30L possibly damaging Het
Inpp5b G A 4: 124,742,649 probably null Het
Itgb2 G A 10: 77,548,761 A239T probably damaging Het
Kcnrg T C 14: 61,607,817 L102P probably damaging Het
Kif16b A T 2: 142,711,707 M1068K probably benign Het
Kifc3 T C 8: 95,110,216 R109G possibly damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Kptn T C 7: 16,123,102 Y172H probably damaging Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrc1 T A 2: 14,306,516 M868K probably benign Het
Mterf1a T C 5: 3,891,854 N5D probably benign Het
Muc5b T C 7: 141,858,608 S1764P unknown Het
Myo9b T C 8: 71,349,055 Y1275H probably damaging Het
Nek1 T C 8: 61,016,296 I129T probably damaging Het
Net1 G A 13: 3,886,740 A221V probably benign Het
Nuak2 A T 1: 132,331,771 D429V probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr648 T A 7: 104,180,241 S56C probably damaging Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Olfr901 T C 9: 38,430,464 Y61H probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh7 T C 5: 57,722,166 V1021A probably damaging Het
Pclo G C 5: 14,679,073 probably benign Het
Pds5a A C 5: 65,615,272 D1329E probably damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pias3 A G 3: 96,703,855 K431E probably damaging Het
Piwil1 T C 5: 128,741,614 S158P probably damaging Het
Plxnc1 A T 10: 94,799,377 I1329N possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pnpla1 T A 17: 28,879,423 probably null Het
Prdm10 T C 9: 31,359,047 Y827H probably damaging Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rgl3 A G 9: 21,988,044 probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rpp40 T C 13: 35,898,698 N254D probably benign Het
Scin T A 12: 40,124,700 H128L probably damaging Het
Sh3bp2 A T 5: 34,556,967 M225L probably benign Het
Shisa9 C A 16: 12,267,548 H324Q possibly damaging Het
Sipa1l1 A G 12: 82,437,827 D1585G probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slc6a13 T C 6: 121,333,342 L320P probably damaging Het
Spats2l A G 1: 57,943,221 T421A probably benign Het
Spryd3 A T 15: 102,128,611 D207E probably benign Het
Srrt T C 5: 137,296,541 N392S possibly damaging Het
Stk36 G T 1: 74,622,345 R510S probably benign Het
Sucnr1 A G 3: 60,086,867 Y272C probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uap1 G T 1: 170,161,463 P130Q probably damaging Het
Ube3c T C 5: 29,601,354 probably null Het
Umad1 A T 6: 8,401,157 probably null Het
Usp34 T C 11: 23,460,665 V2705A possibly damaging Het
Vps13a T C 19: 16,746,058 S259G probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdfy3 T C 5: 101,894,937 T1983A probably benign Het
Wdr24 T G 17: 25,825,779 F203V possibly damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp282 A C 6: 47,877,703 Q11P probably benign Het
Zfp750 T A 11: 121,512,195 T576S probably benign Het
Other mutations in Cc2d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Cc2d1b APN 4 108627378 missense probably damaging 1.00
IGL00507:Cc2d1b APN 4 108629730 missense probably damaging 1.00
IGL00596:Cc2d1b APN 4 108627306 missense probably damaging 1.00
IGL02800:Cc2d1b APN 4 108626136 missense probably benign 0.00
IGL02937:Cc2d1b APN 4 108631894 missense probably damaging 1.00
R0440:Cc2d1b UTSW 4 108625816 critical splice donor site probably null
R1513:Cc2d1b UTSW 4 108633226 missense probably damaging 1.00
R1592:Cc2d1b UTSW 4 108626671 unclassified probably benign
R1663:Cc2d1b UTSW 4 108623547 missense probably damaging 1.00
R4235:Cc2d1b UTSW 4 108625352 intron probably benign
R4361:Cc2d1b UTSW 4 108624750 intron probably benign
R4739:Cc2d1b UTSW 4 108628042 missense probably benign 0.02
R5152:Cc2d1b UTSW 4 108626086 missense probably benign 0.10
R5271:Cc2d1b UTSW 4 108623629 intron probably benign
R5520:Cc2d1b UTSW 4 108626359 missense possibly damaging 0.53
R6196:Cc2d1b UTSW 4 108633225 missense probably damaging 1.00
R6197:Cc2d1b UTSW 4 108633225 missense probably damaging 1.00
R6198:Cc2d1b UTSW 4 108633225 missense probably damaging 1.00
R6220:Cc2d1b UTSW 4 108633225 missense probably damaging 1.00
R6299:Cc2d1b UTSW 4 108628138 missense probably benign 0.01
R7244:Cc2d1b UTSW 4 108629602 missense probably benign 0.32
R7293:Cc2d1b UTSW 4 108631676 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTTGATATCCTGGAGAACCCTTC -3'
(R):5'- GAACTAGGGGAATTGGCTGACTC -3'

Sequencing Primer
(F):5'- GTGGTTCCCAGCACCCATATAG -3'
(R):5'- AATTGGCTGACTCCTCCAGG -3'
Posted On2016-06-06