Incidental Mutation 'R5068:Zfp282'
ID 388435
Institutional Source Beutler Lab
Gene Symbol Zfp282
Ensembl Gene ENSMUSG00000025821
Gene Name zinc finger protein 282
Synonyms HUB1
MMRRC Submission 042658-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R5068 (G1)
Quality Score 204
Status Not validated
Chromosome 6
Chromosomal Location 47854138-47885419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 47854637 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 11 (Q11P)
Ref Sequence ENSEMBL: ENSMUSP00000053643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061890] [ENSMUST00000114598]
AlphaFold E9PVC2
Predicted Effect probably benign
Transcript: ENSMUST00000061890
AA Change: Q11P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: Q11P

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Pfam:DUF3669 98 168 1.8e-12 PFAM
KRAB 198 260 1.04e-21 SMART
internal_repeat_1 317 372 1.1e-13 PROSPERO
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 457 499 N/A INTRINSIC
ZnF_C2H2 514 536 8.94e-3 SMART
ZnF_C2H2 542 564 4.72e-2 SMART
ZnF_C2H2 570 592 1.04e-3 SMART
ZnF_C2H2 598 620 4.24e-4 SMART
ZnF_C2H2 626 648 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114598
SMART Domains Protein: ENSMUSP00000110245
Gene: ENSMUSG00000062519

DomainStartEndE-ValueType
KRAB 11 71 1.38e-17 SMART
low complexity region 146 164 N/A INTRINSIC
ZnF_C2H2 212 233 6.31e1 SMART
ZnF_C2H2 267 289 3.58e-2 SMART
ZnF_C2H2 296 318 1.36e-2 SMART
ZnF_C2H2 324 346 1.69e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 6.78e-3 SMART
ZnF_C2H2 408 430 9.08e-4 SMART
ZnF_C2H2 436 459 5.14e-3 SMART
low complexity region 466 479 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
6030468B19Rik A G 11: 117,693,701 (GRCm39) Y56C possibly damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Add2 T A 6: 86,084,440 (GRCm39) L496Q probably damaging Het
Akt1s1 T C 7: 44,499,432 (GRCm39) probably null Het
Als2 G T 1: 59,250,433 (GRCm39) P437Q probably benign Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd17 T C 5: 90,402,667 (GRCm39) R1464G probably damaging Het
Ankrd24 T C 10: 81,475,699 (GRCm39) S121P possibly damaging Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Bnip3l T C 14: 67,237,081 (GRCm39) E57G possibly damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cc2d1b T C 4: 108,480,661 (GRCm39) V27A possibly damaging Het
Cdc37 T C 9: 21,061,099 (GRCm39) T19A probably damaging Het
Cep152 T C 2: 125,413,736 (GRCm39) I1199V probably benign Het
Chd6 G T 2: 160,808,289 (GRCm39) L1642I possibly damaging Het
Chst13 T C 6: 90,286,551 (GRCm39) E137G possibly damaging Het
Cnrip1 A G 11: 17,004,687 (GRCm39) D79G probably damaging Het
Dars2 A T 1: 160,869,483 (GRCm39) C589S probably benign Het
Dhx15 T G 5: 52,327,409 (GRCm39) I102L possibly damaging Het
Dip2a A G 10: 76,153,877 (GRCm39) L151P possibly damaging Het
Dlc1 T C 8: 37,405,184 (GRCm39) T202A probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dlgap4 T C 2: 156,549,031 (GRCm39) F464L probably benign Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Dthd1 C A 5: 62,976,059 (GRCm39) D244E probably benign Het
Dtl A T 1: 191,300,485 (GRCm39) D126E probably damaging Het
Ell2 A G 13: 75,911,737 (GRCm39) N341S probably benign Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Erbb4 A T 1: 68,083,061 (GRCm39) probably null Het
Erc2 A T 14: 28,024,900 (GRCm39) H593L possibly damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Fyn A G 10: 39,402,839 (GRCm39) K204E probably damaging Het
Gm4847 A T 1: 166,465,953 (GRCm39) F212Y possibly damaging Het
Gpc5 T C 14: 115,654,676 (GRCm39) *499R probably null Het
Hcn4 T C 9: 58,767,304 (GRCm39) L955P unknown Het
Hook2 C A 8: 85,720,028 (GRCm39) L111I possibly damaging Het
Hook3 C T 8: 26,585,785 (GRCm39) probably null Het
Hvcn1 T C 5: 122,371,544 (GRCm39) F28S probably damaging Het
Igkv6-32 A G 6: 70,051,267 (GRCm39) F30L possibly damaging Het
Inpp5b G A 4: 124,636,442 (GRCm39) probably null Het
Itgb2 G A 10: 77,384,595 (GRCm39) A239T probably damaging Het
Kcnrg T C 14: 61,845,266 (GRCm39) L102P probably damaging Het
Kif16b A T 2: 142,553,627 (GRCm39) M1068K probably benign Het
Kifc3 T C 8: 95,836,844 (GRCm39) R109G possibly damaging Het
Klhl28 A T 12: 65,004,486 (GRCm39) M9K probably benign Het
Kptn T C 7: 15,857,027 (GRCm39) Y172H probably damaging Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Mrc1 T A 2: 14,311,327 (GRCm39) M868K probably benign Het
Mterf1a T C 5: 3,941,854 (GRCm39) N5D probably benign Het
Muc5b T C 7: 141,412,345 (GRCm39) S1764P unknown Het
Myo9b T C 8: 71,801,699 (GRCm39) Y1275H probably damaging Het
Nek1 T C 8: 61,469,330 (GRCm39) I129T probably damaging Het
Net1 G A 13: 3,936,740 (GRCm39) A221V probably benign Het
Nuak2 A T 1: 132,259,509 (GRCm39) D429V probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or52h1 T A 7: 103,829,448 (GRCm39) S56C probably damaging Het
Or8b42 T C 9: 38,341,760 (GRCm39) Y61H probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdh7 T C 5: 57,879,508 (GRCm39) V1021A probably damaging Het
Pclo G C 5: 14,729,087 (GRCm39) probably benign Het
Pds5a A C 5: 65,772,615 (GRCm39) D1329E probably damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pias3 A G 3: 96,611,171 (GRCm39) K431E probably damaging Het
Piwil1 T C 5: 128,818,678 (GRCm39) S158P probably damaging Het
Plxnc1 A T 10: 94,635,239 (GRCm39) I1329N possibly damaging Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Pnpla1 T A 17: 29,098,397 (GRCm39) probably null Het
Prdm10 T C 9: 31,270,343 (GRCm39) Y827H probably damaging Het
Prss3b A C 6: 41,009,370 (GRCm39) Y155D probably benign Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rgl3 A G 9: 21,899,340 (GRCm39) probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rpp40 T C 13: 36,082,681 (GRCm39) N254D probably benign Het
Scin T A 12: 40,174,699 (GRCm39) H128L probably damaging Het
Sh3bp2 A T 5: 34,714,311 (GRCm39) M225L probably benign Het
Shisa9 C A 16: 12,085,412 (GRCm39) H324Q possibly damaging Het
Sipa1l1 A G 12: 82,484,601 (GRCm39) D1585G probably damaging Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slc6a13 T C 6: 121,310,301 (GRCm39) L320P probably damaging Het
Spats2l A G 1: 57,982,380 (GRCm39) T421A probably benign Het
Spryd3 A T 15: 102,037,046 (GRCm39) D207E probably benign Het
Srrt T C 5: 137,294,803 (GRCm39) N392S possibly damaging Het
Stk36 G T 1: 74,661,504 (GRCm39) R510S probably benign Het
Sucnr1 A G 3: 59,994,288 (GRCm39) Y272C probably damaging Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tmem131 A G 1: 36,893,986 (GRCm39) I139T probably damaging Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Tsc22d1 T C 14: 76,655,750 (GRCm39) I661T probably benign Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Uap1 G T 1: 169,989,032 (GRCm39) P130Q probably damaging Het
Ube3c T C 5: 29,806,352 (GRCm39) probably null Het
Umad1 A T 6: 8,401,157 (GRCm39) probably null Het
Usp34 T C 11: 23,410,665 (GRCm39) V2705A possibly damaging Het
Vps13a T C 19: 16,723,422 (GRCm39) S259G probably benign Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wdfy3 T C 5: 102,042,803 (GRCm39) T1983A probably benign Het
Wdr24 T G 17: 26,044,753 (GRCm39) F203V possibly damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Zfp750 T A 11: 121,403,021 (GRCm39) T576S probably benign Het
Other mutations in Zfp282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp282 APN 6 47,857,324 (GRCm39) missense probably damaging 1.00
IGL00755:Zfp282 APN 6 47,857,324 (GRCm39) missense probably damaging 1.00
IGL01402:Zfp282 APN 6 47,874,770 (GRCm39) missense probably damaging 0.99
IGL01404:Zfp282 APN 6 47,874,770 (GRCm39) missense probably damaging 0.99
IGL01484:Zfp282 APN 6 47,867,054 (GRCm39) missense possibly damaging 0.76
IGL01560:Zfp282 APN 6 47,857,211 (GRCm39) missense probably damaging 1.00
IGL02949:Zfp282 APN 6 47,874,848 (GRCm39) missense probably damaging 1.00
FR4304:Zfp282 UTSW 6 47,881,731 (GRCm39) small insertion probably benign
FR4589:Zfp282 UTSW 6 47,881,725 (GRCm39) small insertion probably benign
FR4737:Zfp282 UTSW 6 47,881,733 (GRCm39) small insertion probably benign
FR4737:Zfp282 UTSW 6 47,881,724 (GRCm39) small insertion probably benign
FR4976:Zfp282 UTSW 6 47,881,724 (GRCm39) small insertion probably benign
R0020:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R0020:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R0118:Zfp282 UTSW 6 47,869,866 (GRCm39) missense probably benign 0.34
R0415:Zfp282 UTSW 6 47,881,987 (GRCm39) missense possibly damaging 0.88
R0415:Zfp282 UTSW 6 47,874,815 (GRCm39) missense probably damaging 0.99
R0607:Zfp282 UTSW 6 47,857,303 (GRCm39) missense probably damaging 1.00
R0710:Zfp282 UTSW 6 47,857,318 (GRCm39) missense probably damaging 1.00
R0946:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R1054:Zfp282 UTSW 6 47,881,533 (GRCm39) missense probably benign 0.00
R1401:Zfp282 UTSW 6 47,867,108 (GRCm39) nonsense probably null
R1572:Zfp282 UTSW 6 47,869,801 (GRCm39) missense probably damaging 1.00
R2016:Zfp282 UTSW 6 47,874,721 (GRCm39) splice site probably null
R2971:Zfp282 UTSW 6 47,874,866 (GRCm39) splice site probably null
R4064:Zfp282 UTSW 6 47,857,028 (GRCm39) missense probably damaging 0.99
R4478:Zfp282 UTSW 6 47,867,630 (GRCm39) nonsense probably null
R4530:Zfp282 UTSW 6 47,867,567 (GRCm39) missense probably benign 0.00
R4532:Zfp282 UTSW 6 47,867,567 (GRCm39) missense probably benign 0.00
R5261:Zfp282 UTSW 6 47,874,824 (GRCm39) missense probably damaging 0.99
R5326:Zfp282 UTSW 6 47,882,261 (GRCm39) missense probably benign
R5551:Zfp282 UTSW 6 47,867,579 (GRCm39) missense possibly damaging 0.59
R6046:Zfp282 UTSW 6 47,857,102 (GRCm39) missense probably damaging 1.00
R6408:Zfp282 UTSW 6 47,857,319 (GRCm39) missense probably damaging 1.00
R7535:Zfp282 UTSW 6 47,881,878 (GRCm39) missense probably benign 0.03
R8098:Zfp282 UTSW 6 47,867,652 (GRCm39) missense probably benign 0.00
R8158:Zfp282 UTSW 6 47,867,626 (GRCm39) missense possibly damaging 0.61
R8304:Zfp282 UTSW 6 47,881,722 (GRCm39) small deletion probably benign
R8385:Zfp282 UTSW 6 47,882,023 (GRCm39) missense possibly damaging 0.88
R8543:Zfp282 UTSW 6 47,881,561 (GRCm39) missense probably benign 0.40
R8817:Zfp282 UTSW 6 47,881,760 (GRCm39) missense probably benign 0.00
S24628:Zfp282 UTSW 6 47,881,987 (GRCm39) missense possibly damaging 0.88
S24628:Zfp282 UTSW 6 47,874,815 (GRCm39) missense probably damaging 0.99
Z1177:Zfp282 UTSW 6 47,867,571 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCGCCGTCAGATTTCTTTG -3'
(R):5'- TGGTTAAACTGTTCCCTCTGTG -3'

Sequencing Primer
(F):5'- AGGAGCTCCGAGGCCATTG -3'
(R):5'- TCAGTGAAGCGGCCACTAC -3'
Posted On 2016-06-06