Incidental Mutation 'R5068:Slc5a8'
ID388466
Institutional Source Beutler Lab
Gene Symbol Slc5a8
Ensembl Gene ENSMUSG00000020062
Gene Namesolute carrier family 5 (iodide transporter), member 8
SynonymsSMCT
MMRRC Submission 042658-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5068 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88885992-88929515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88886598 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 98 (I98F)
Ref Sequence ENSEMBL: ENSMUSP00000020255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020255
AA Change: I98F

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: I98F

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:SSF 45 449 2.6e-38 PFAM
low complexity region 462 478 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,436 Y155D probably benign Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
6030468B19Rik A G 11: 117,802,875 Y56C possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Add2 T A 6: 86,107,458 L496Q probably damaging Het
Akt1s1 T C 7: 44,850,008 probably null Het
Als2 G T 1: 59,211,274 P437Q probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd17 T C 5: 90,254,808 R1464G probably damaging Het
Ankrd24 T C 10: 81,639,865 S121P possibly damaging Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Bnip3l T C 14: 66,999,632 E57G possibly damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cc2d1b T C 4: 108,623,464 V27A possibly damaging Het
Cdc37 T C 9: 21,149,803 T19A probably damaging Het
Cep152 T C 2: 125,571,816 I1199V probably benign Het
Chd6 G T 2: 160,966,369 L1642I possibly damaging Het
Chst13 T C 6: 90,309,569 E137G possibly damaging Het
Cnrip1 A G 11: 17,054,687 D79G probably damaging Het
Dars2 A T 1: 161,041,913 C589S probably benign Het
Dhx15 T G 5: 52,170,067 I102L possibly damaging Het
Dip2a A G 10: 76,318,043 L151P possibly damaging Het
Dlc1 T C 8: 36,938,030 T202A probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dlgap4 T C 2: 156,707,111 F464L probably benign Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Dthd1 C A 5: 62,818,716 D244E probably benign Het
Dtl A T 1: 191,568,373 D126E probably damaging Het
Ell2 A G 13: 75,763,618 N341S probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Erbb4 A T 1: 68,043,902 probably null Het
Erc2 A T 14: 28,302,943 H593L possibly damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fyn A G 10: 39,526,843 K204E probably damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gm4847 A T 1: 166,638,384 F212Y possibly damaging Het
Gpc5 T C 14: 115,417,264 *499R probably null Het
Hcn4 T C 9: 58,860,021 L955P unknown Het
Hook2 C A 8: 84,993,399 L111I possibly damaging Het
Hook3 C T 8: 26,095,757 probably null Het
Hvcn1 T C 5: 122,233,481 F28S probably damaging Het
Igkv6-32 A G 6: 70,074,283 F30L possibly damaging Het
Inpp5b G A 4: 124,742,649 probably null Het
Itgb2 G A 10: 77,548,761 A239T probably damaging Het
Kcnrg T C 14: 61,607,817 L102P probably damaging Het
Kif16b A T 2: 142,711,707 M1068K probably benign Het
Kifc3 T C 8: 95,110,216 R109G possibly damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Kptn T C 7: 16,123,102 Y172H probably damaging Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrc1 T A 2: 14,306,516 M868K probably benign Het
Mterf1a T C 5: 3,891,854 N5D probably benign Het
Muc5b T C 7: 141,858,608 S1764P unknown Het
Myo9b T C 8: 71,349,055 Y1275H probably damaging Het
Nek1 T C 8: 61,016,296 I129T probably damaging Het
Net1 G A 13: 3,886,740 A221V probably benign Het
Nuak2 A T 1: 132,331,771 D429V probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr648 T A 7: 104,180,241 S56C probably damaging Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Olfr901 T C 9: 38,430,464 Y61H probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh7 T C 5: 57,722,166 V1021A probably damaging Het
Pclo G C 5: 14,679,073 probably benign Het
Pds5a A C 5: 65,615,272 D1329E probably damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pias3 A G 3: 96,703,855 K431E probably damaging Het
Piwil1 T C 5: 128,741,614 S158P probably damaging Het
Plxnc1 A T 10: 94,799,377 I1329N possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pnpla1 T A 17: 28,879,423 probably null Het
Prdm10 T C 9: 31,359,047 Y827H probably damaging Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rgl3 A G 9: 21,988,044 probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rpp40 T C 13: 35,898,698 N254D probably benign Het
Scin T A 12: 40,124,700 H128L probably damaging Het
Sh3bp2 A T 5: 34,556,967 M225L probably benign Het
Shisa9 C A 16: 12,267,548 H324Q possibly damaging Het
Sipa1l1 A G 12: 82,437,827 D1585G probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc6a13 T C 6: 121,333,342 L320P probably damaging Het
Spats2l A G 1: 57,943,221 T421A probably benign Het
Spryd3 A T 15: 102,128,611 D207E probably benign Het
Srrt T C 5: 137,296,541 N392S possibly damaging Het
Stk36 G T 1: 74,622,345 R510S probably benign Het
Sucnr1 A G 3: 60,086,867 Y272C probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uap1 G T 1: 170,161,463 P130Q probably damaging Het
Ube3c T C 5: 29,601,354 probably null Het
Umad1 A T 6: 8,401,157 probably null Het
Usp34 T C 11: 23,460,665 V2705A possibly damaging Het
Vps13a T C 19: 16,746,058 S259G probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdfy3 T C 5: 101,894,937 T1983A probably benign Het
Wdr24 T G 17: 25,825,779 F203V possibly damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp282 A C 6: 47,877,703 Q11P probably benign Het
Zfp750 T A 11: 121,512,195 T576S probably benign Het
Other mutations in Slc5a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Slc5a8 APN 10 88908040 missense possibly damaging 0.91
IGL00902:Slc5a8 APN 10 88919461 missense probably benign 0.03
IGL00960:Slc5a8 APN 10 88921765 missense probably benign 0.21
IGL01109:Slc5a8 APN 10 88906392 missense possibly damaging 0.95
IGL01365:Slc5a8 APN 10 88892097 splice site probably benign
IGL01418:Slc5a8 APN 10 88905033 missense probably damaging 1.00
IGL01823:Slc5a8 APN 10 88919472 nonsense probably null
IGL02116:Slc5a8 APN 10 88919500 missense probably benign
IGL03109:Slc5a8 APN 10 88906416 splice site probably benign
PIT4585001:Slc5a8 UTSW 10 88886503 missense probably damaging 1.00
R0010:Slc5a8 UTSW 10 88886590 missense probably benign 0.03
R0418:Slc5a8 UTSW 10 88886558 missense probably benign 0.01
R1233:Slc5a8 UTSW 10 88918442 missense probably damaging 1.00
R1656:Slc5a8 UTSW 10 88925786 critical splice donor site probably null
R1769:Slc5a8 UTSW 10 88919464 missense probably benign
R1769:Slc5a8 UTSW 10 88919466 nonsense probably null
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2873:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R3883:Slc5a8 UTSW 10 88902463 missense possibly damaging 0.89
R4207:Slc5a8 UTSW 10 88911413 missense probably damaging 1.00
R4731:Slc5a8 UTSW 10 88925787 critical splice donor site probably null
R4880:Slc5a8 UTSW 10 88892024 missense probably damaging 1.00
R4969:Slc5a8 UTSW 10 88904912 splice site probably null
R4998:Slc5a8 UTSW 10 88908057 critical splice donor site probably null
R5009:Slc5a8 UTSW 10 88909654 missense probably benign 0.07
R5069:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5070:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5130:Slc5a8 UTSW 10 88926215 missense probably benign
R5141:Slc5a8 UTSW 10 88919560 critical splice donor site probably null
R5252:Slc5a8 UTSW 10 88906347 missense probably damaging 1.00
R5659:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5660:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5661:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6378:Slc5a8 UTSW 10 88905054 missense probably damaging 1.00
R7214:Slc5a8 UTSW 10 88919502 missense probably benign
R7255:Slc5a8 UTSW 10 88909631 missense probably damaging 1.00
R7526:Slc5a8 UTSW 10 88902491 missense probably damaging 1.00
R7604:Slc5a8 UTSW 10 88904960 missense possibly damaging 0.78
R7688:Slc5a8 UTSW 10 88921699 missense probably damaging 1.00
R7869:Slc5a8 UTSW 10 88921705 missense probably benign 0.15
R7952:Slc5a8 UTSW 10 88921705 missense probably benign 0.15
Z1177:Slc5a8 UTSW 10 88909613 missense not run
Predicted Primers PCR Primer
(F):5'- AGACCTCCAAGGACTTTCTTATGG -3'
(R):5'- CCTCTTAGAAGCCGCATGTC -3'

Sequencing Primer
(F):5'- CAAGGACTTTCTTATGGGCGGTC -3'
(R):5'- AGAAGCCGCATGTCTCTATG -3'
Posted On2016-06-06