Mutagenetix > Incidental Mutation

Incidental Mutation 'R5068:Tph2'

388467

Institutional Source

Beutler Lab

Gene Symbol

Tph2

Ensembl Gene

ENSMUSG00000006764

Gene Name

tryptophan hydroxylase 2

Synonyms

MMRRC Submission

042658-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.297) question?

Stock #

R5068 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115078641-115185022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115151174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 237 (Y237F)

Ref Sequence

ENSEMBL: ENSMUSP00000006949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006949]

AlphaFold

Q8CGV2

Predicted Effect

probably benign
Transcript: ENSMUST00000006949
AA Change: Y237F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: Y237F

Domain	Start	End	E-Value	Type
low complexity region	94	102	N/A	INTRINSIC
Pfam:Biopterin_H	150	480	3.6e-177	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	C	6: 41,032,436	Y155D	probably benign	Het
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
6030468B19Rik	A	G	11: 117,802,875	Y56C	possibly damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Add2	T	A	6: 86,107,458	L496Q	probably damaging	Het
Akt1s1	T	C	7: 44,850,008		probably null	Het
Als2	G	T	1: 59,211,274	P437Q	probably benign	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd17	T	C	5: 90,254,808	R1464G	probably damaging	Het
Ankrd24	T	C	10: 81,639,865	S121P	possibly damaging	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Bnip3l	T	C	14: 66,999,632	E57G	possibly damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cc2d1b	T	C	4: 108,623,464	V27A	possibly damaging	Het
Cdc37	T	C	9: 21,149,803	T19A	probably damaging	Het
Cep152	T	C	2: 125,571,816	I1199V	probably benign	Het
Chd6	G	T	2: 160,966,369	L1642I	possibly damaging	Het
Chst13	T	C	6: 90,309,569	E137G	possibly damaging	Het
Cnrip1	A	G	11: 17,054,687	D79G	probably damaging	Het
Dars2	A	T	1: 161,041,913	C589S	probably benign	Het
Dhx15	T	G	5: 52,170,067	I102L	possibly damaging	Het
Dip2a	A	G	10: 76,318,043	L151P	possibly damaging	Het
Dlc1	T	C	8: 36,938,030	T202A	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dlgap4	T	C	2: 156,707,111	F464L	probably benign	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Dthd1	C	A	5: 62,818,716	D244E	probably benign	Het
Dtl	A	T	1: 191,568,373	D126E	probably damaging	Het
Ell2	A	G	13: 75,763,618	N341S	probably benign	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Erbb4	A	T	1: 68,043,902		probably null	Het
Erc2	A	T	14: 28,302,943	H593L	possibly damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Fyn	A	G	10: 39,526,843	K204E	probably damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gm4847	A	T	1: 166,638,384	F212Y	possibly damaging	Het
Gpc5	T	C	14: 115,417,264	*499R	probably null	Het
Hcn4	T	C	9: 58,860,021	L955P	unknown	Het
Hook2	C	A	8: 84,993,399	L111I	possibly damaging	Het
Hook3	C	T	8: 26,095,757		probably null	Het
Hvcn1	T	C	5: 122,233,481	F28S	probably damaging	Het
Igkv6-32	A	G	6: 70,074,283	F30L	possibly damaging	Het
Inpp5b	G	A	4: 124,742,649		probably null	Het
Itgb2	G	A	10: 77,548,761	A239T	probably damaging	Het
Kcnrg	T	C	14: 61,607,817	L102P	probably damaging	Het
Kif16b	A	T	2: 142,711,707	M1068K	probably benign	Het
Kifc3	T	C	8: 95,110,216	R109G	possibly damaging	Het
Klhl28	A	T	12: 64,957,712	M9K	probably benign	Het
Kptn	T	C	7: 16,123,102	Y172H	probably damaging	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Mrc1	T	A	2: 14,306,516	M868K	probably benign	Het
Mterf1a	T	C	5: 3,891,854	N5D	probably benign	Het
Muc5b	T	C	7: 141,858,608	S1764P	unknown	Het
Myo9b	T	C	8: 71,349,055	Y1275H	probably damaging	Het
Nek1	T	C	8: 61,016,296	I129T	probably damaging	Het
Net1	G	A	13: 3,886,740	A221V	probably benign	Het
Nuak2	A	T	1: 132,331,771	D429V	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr648	T	A	7: 104,180,241	S56C	probably damaging	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Olfr901	T	C	9: 38,430,464	Y61H	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh7	T	C	5: 57,722,166	V1021A	probably damaging	Het
Pclo	G	C	5: 14,679,073		probably benign	Het
Pds5a	A	C	5: 65,615,272	D1329E	probably damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pias3	A	G	3: 96,703,855	K431E	probably damaging	Het
Piwil1	T	C	5: 128,741,614	S158P	probably damaging	Het
Plxnc1	A	T	10: 94,799,377	I1329N	possibly damaging	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Pnpla1	T	A	17: 28,879,423		probably null	Het
Prdm10	T	C	9: 31,359,047	Y827H	probably damaging	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rgl3	A	G	9: 21,988,044		probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rpp40	T	C	13: 35,898,698	N254D	probably benign	Het
Scin	T	A	12: 40,124,700	H128L	probably damaging	Het
Sh3bp2	A	T	5: 34,556,967	M225L	probably benign	Het
Shisa9	C	A	16: 12,267,548	H324Q	possibly damaging	Het
Sipa1l1	A	G	12: 82,437,827	D1585G	probably damaging	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slc6a13	T	C	6: 121,333,342	L320P	probably damaging	Het
Spats2l	A	G	1: 57,943,221	T421A	probably benign	Het
Spryd3	A	T	15: 102,128,611	D207E	probably benign	Het
Srrt	T	C	5: 137,296,541	N392S	possibly damaging	Het
Stk36	G	T	1: 74,622,345	R510S	probably benign	Het
Sucnr1	A	G	3: 60,086,867	Y272C	probably damaging	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tmem131	A	G	1: 36,854,905	I139T	probably damaging	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Tsc22d1	T	C	14: 76,418,310	I661T	probably benign	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Uap1	G	T	1: 170,161,463	P130Q	probably damaging	Het
Ube3c	T	C	5: 29,601,354		probably null	Het
Umad1	A	T	6: 8,401,157		probably null	Het
Usp34	T	C	11: 23,460,665	V2705A	possibly damaging	Het
Vps13a	T	C	19: 16,746,058	S259G	probably benign	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wdfy3	T	C	5: 101,894,937	T1983A	probably benign	Het
Wdr24	T	G	17: 25,825,779	F203V	possibly damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het
Zfp282	A	C	6: 47,877,703	Q11P	probably benign	Het
Zfp750	T	A	11: 121,512,195	T576S	probably benign	Het

Other mutations in Tph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Tph2	APN	10	115079759	nonsense	probably null
IGL01989:Tph2	APN	10	115146016	missense	probably benign	0.22
IGL02363:Tph2	APN	10	115079981	missense	probably benign	0.01
IGL02667:Tph2	APN	10	115080045	missense	probably benign	0.43
R0390:Tph2	UTSW	10	115174109	missense	probably damaging	1.00
R0400:Tph2	UTSW	10	115080120	splice site	probably benign
R0570:Tph2	UTSW	10	115174134	splice site	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1654:Tph2	UTSW	10	115184807	missense	probably benign
R3705:Tph2	UTSW	10	115119893	nonsense	probably null
R3710:Tph2	UTSW	10	115174058	missense	probably benign	0.42
R3777:Tph2	UTSW	10	115080005	missense	probably benign
R4794:Tph2	UTSW	10	115182770	missense	possibly damaging	0.84
R5015:Tph2	UTSW	10	115079716	missense	probably benign	0.01
R5069:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5070:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5422:Tph2	UTSW	10	115079764	missense	possibly damaging	0.94
R5487:Tph2	UTSW	10	115119874	missense	probably damaging	1.00
R5604:Tph2	UTSW	10	115090709	missense	probably damaging	1.00
R5692:Tph2	UTSW	10	115184827	missense	probably damaging	0.97
R6368:Tph2	UTSW	10	115179326	missense	probably damaging	1.00
R6802:Tph2	UTSW	10	115184873	missense	probably damaging	1.00
R6823:Tph2	UTSW	10	115174106	missense	probably benign	0.02
R7371:Tph2	UTSW	10	115151111	missense	probably damaging	1.00
R7724:Tph2	UTSW	10	115079822	missense	probably benign
R7863:Tph2	UTSW	10	115080001	missense	probably damaging	1.00
R8046:Tph2	UTSW	10	115179594	missense	possibly damaging	0.62
R8738:Tph2	UTSW	10	115179709	splice site	probably benign
R9464:Tph2	UTSW	10	115080087	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGGAGCTATTGGTGTGCCC -3'
(R):5'- CTGGAATCCTTTCGGACACTTAC -3'

Sequencing Primer
(F):5'- GTGCCCTGTGTCCTTGAAAAGC -3'
(R):5'- CGGACACTTACTTATTCCAGTGTGTG -3'

Posted On

2016-06-06