Incidental Mutation 'R5068:Tph2'
ID 388467
Institutional Source Beutler Lab
Gene Symbol Tph2
Ensembl Gene ENSMUSG00000006764
Gene Name tryptophan hydroxylase 2
Synonyms
MMRRC Submission 042658-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.297) question?
Stock # R5068 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 114914546-115020927 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114987079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 237 (Y237F)
Ref Sequence ENSEMBL: ENSMUSP00000006949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006949]
AlphaFold Q8CGV2
Predicted Effect probably benign
Transcript: ENSMUST00000006949
AA Change: Y237F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: Y237F

DomainStartEndE-ValueType
low complexity region 94 102 N/A INTRINSIC
Pfam:Biopterin_H 150 480 3.6e-177 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
6030468B19Rik A G 11: 117,693,701 (GRCm39) Y56C possibly damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Add2 T A 6: 86,084,440 (GRCm39) L496Q probably damaging Het
Akt1s1 T C 7: 44,499,432 (GRCm39) probably null Het
Als2 G T 1: 59,250,433 (GRCm39) P437Q probably benign Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd17 T C 5: 90,402,667 (GRCm39) R1464G probably damaging Het
Ankrd24 T C 10: 81,475,699 (GRCm39) S121P possibly damaging Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Bnip3l T C 14: 67,237,081 (GRCm39) E57G possibly damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cc2d1b T C 4: 108,480,661 (GRCm39) V27A possibly damaging Het
Cdc37 T C 9: 21,061,099 (GRCm39) T19A probably damaging Het
Cep152 T C 2: 125,413,736 (GRCm39) I1199V probably benign Het
Chd6 G T 2: 160,808,289 (GRCm39) L1642I possibly damaging Het
Chst13 T C 6: 90,286,551 (GRCm39) E137G possibly damaging Het
Cnrip1 A G 11: 17,004,687 (GRCm39) D79G probably damaging Het
Dars2 A T 1: 160,869,483 (GRCm39) C589S probably benign Het
Dhx15 T G 5: 52,327,409 (GRCm39) I102L possibly damaging Het
Dip2a A G 10: 76,153,877 (GRCm39) L151P possibly damaging Het
Dlc1 T C 8: 37,405,184 (GRCm39) T202A probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dlgap4 T C 2: 156,549,031 (GRCm39) F464L probably benign Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Dthd1 C A 5: 62,976,059 (GRCm39) D244E probably benign Het
Dtl A T 1: 191,300,485 (GRCm39) D126E probably damaging Het
Ell2 A G 13: 75,911,737 (GRCm39) N341S probably benign Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Erbb4 A T 1: 68,083,061 (GRCm39) probably null Het
Erc2 A T 14: 28,024,900 (GRCm39) H593L possibly damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Fyn A G 10: 39,402,839 (GRCm39) K204E probably damaging Het
Gm4847 A T 1: 166,465,953 (GRCm39) F212Y possibly damaging Het
Gpc5 T C 14: 115,654,676 (GRCm39) *499R probably null Het
Hcn4 T C 9: 58,767,304 (GRCm39) L955P unknown Het
Hook2 C A 8: 85,720,028 (GRCm39) L111I possibly damaging Het
Hook3 C T 8: 26,585,785 (GRCm39) probably null Het
Hvcn1 T C 5: 122,371,544 (GRCm39) F28S probably damaging Het
Igkv6-32 A G 6: 70,051,267 (GRCm39) F30L possibly damaging Het
Inpp5b G A 4: 124,636,442 (GRCm39) probably null Het
Itgb2 G A 10: 77,384,595 (GRCm39) A239T probably damaging Het
Kcnrg T C 14: 61,845,266 (GRCm39) L102P probably damaging Het
Kif16b A T 2: 142,553,627 (GRCm39) M1068K probably benign Het
Kifc3 T C 8: 95,836,844 (GRCm39) R109G possibly damaging Het
Klhl28 A T 12: 65,004,486 (GRCm39) M9K probably benign Het
Kptn T C 7: 15,857,027 (GRCm39) Y172H probably damaging Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Mrc1 T A 2: 14,311,327 (GRCm39) M868K probably benign Het
Mterf1a T C 5: 3,941,854 (GRCm39) N5D probably benign Het
Muc5b T C 7: 141,412,345 (GRCm39) S1764P unknown Het
Myo9b T C 8: 71,801,699 (GRCm39) Y1275H probably damaging Het
Nek1 T C 8: 61,469,330 (GRCm39) I129T probably damaging Het
Net1 G A 13: 3,936,740 (GRCm39) A221V probably benign Het
Nuak2 A T 1: 132,259,509 (GRCm39) D429V probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or52h1 T A 7: 103,829,448 (GRCm39) S56C probably damaging Het
Or8b42 T C 9: 38,341,760 (GRCm39) Y61H probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdh7 T C 5: 57,879,508 (GRCm39) V1021A probably damaging Het
Pclo G C 5: 14,729,087 (GRCm39) probably benign Het
Pds5a A C 5: 65,772,615 (GRCm39) D1329E probably damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pias3 A G 3: 96,611,171 (GRCm39) K431E probably damaging Het
Piwil1 T C 5: 128,818,678 (GRCm39) S158P probably damaging Het
Plxnc1 A T 10: 94,635,239 (GRCm39) I1329N possibly damaging Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Pnpla1 T A 17: 29,098,397 (GRCm39) probably null Het
Prdm10 T C 9: 31,270,343 (GRCm39) Y827H probably damaging Het
Prss3b A C 6: 41,009,370 (GRCm39) Y155D probably benign Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rgl3 A G 9: 21,899,340 (GRCm39) probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rpp40 T C 13: 36,082,681 (GRCm39) N254D probably benign Het
Scin T A 12: 40,174,699 (GRCm39) H128L probably damaging Het
Sh3bp2 A T 5: 34,714,311 (GRCm39) M225L probably benign Het
Shisa9 C A 16: 12,085,412 (GRCm39) H324Q possibly damaging Het
Sipa1l1 A G 12: 82,484,601 (GRCm39) D1585G probably damaging Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slc6a13 T C 6: 121,310,301 (GRCm39) L320P probably damaging Het
Spats2l A G 1: 57,982,380 (GRCm39) T421A probably benign Het
Spryd3 A T 15: 102,037,046 (GRCm39) D207E probably benign Het
Srrt T C 5: 137,294,803 (GRCm39) N392S possibly damaging Het
Stk36 G T 1: 74,661,504 (GRCm39) R510S probably benign Het
Sucnr1 A G 3: 59,994,288 (GRCm39) Y272C probably damaging Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tmem131 A G 1: 36,893,986 (GRCm39) I139T probably damaging Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Tsc22d1 T C 14: 76,655,750 (GRCm39) I661T probably benign Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Uap1 G T 1: 169,989,032 (GRCm39) P130Q probably damaging Het
Ube3c T C 5: 29,806,352 (GRCm39) probably null Het
Umad1 A T 6: 8,401,157 (GRCm39) probably null Het
Usp34 T C 11: 23,410,665 (GRCm39) V2705A possibly damaging Het
Vps13a T C 19: 16,723,422 (GRCm39) S259G probably benign Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wdfy3 T C 5: 102,042,803 (GRCm39) T1983A probably benign Het
Wdr24 T G 17: 26,044,753 (GRCm39) F203V possibly damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Zfp282 A C 6: 47,854,637 (GRCm39) Q11P probably benign Het
Zfp750 T A 11: 121,403,021 (GRCm39) T576S probably benign Het
Other mutations in Tph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Tph2 APN 10 114,915,664 (GRCm39) nonsense probably null
IGL01989:Tph2 APN 10 114,981,921 (GRCm39) missense probably benign 0.22
IGL02363:Tph2 APN 10 114,915,886 (GRCm39) missense probably benign 0.01
IGL02667:Tph2 APN 10 114,915,950 (GRCm39) missense probably benign 0.43
R0390:Tph2 UTSW 10 115,010,014 (GRCm39) missense probably damaging 1.00
R0400:Tph2 UTSW 10 114,916,025 (GRCm39) splice site probably benign
R0570:Tph2 UTSW 10 115,010,039 (GRCm39) splice site probably benign
R1466:Tph2 UTSW 10 114,915,600 (GRCm39) missense probably benign
R1466:Tph2 UTSW 10 114,915,600 (GRCm39) missense probably benign
R1654:Tph2 UTSW 10 115,020,712 (GRCm39) missense probably benign
R3705:Tph2 UTSW 10 114,955,798 (GRCm39) nonsense probably null
R3710:Tph2 UTSW 10 115,009,963 (GRCm39) missense probably benign 0.42
R3777:Tph2 UTSW 10 114,915,910 (GRCm39) missense probably benign
R4794:Tph2 UTSW 10 115,018,675 (GRCm39) missense possibly damaging 0.84
R5015:Tph2 UTSW 10 114,915,621 (GRCm39) missense probably benign 0.01
R5069:Tph2 UTSW 10 114,987,079 (GRCm39) missense probably benign 0.00
R5070:Tph2 UTSW 10 114,987,079 (GRCm39) missense probably benign 0.00
R5422:Tph2 UTSW 10 114,915,669 (GRCm39) missense possibly damaging 0.94
R5487:Tph2 UTSW 10 114,955,779 (GRCm39) missense probably damaging 1.00
R5604:Tph2 UTSW 10 114,926,614 (GRCm39) missense probably damaging 1.00
R5692:Tph2 UTSW 10 115,020,732 (GRCm39) missense probably damaging 0.97
R6368:Tph2 UTSW 10 115,015,231 (GRCm39) missense probably damaging 1.00
R6802:Tph2 UTSW 10 115,020,778 (GRCm39) missense probably damaging 1.00
R6823:Tph2 UTSW 10 115,010,011 (GRCm39) missense probably benign 0.02
R7371:Tph2 UTSW 10 114,987,016 (GRCm39) missense probably damaging 1.00
R7724:Tph2 UTSW 10 114,915,727 (GRCm39) missense probably benign
R7863:Tph2 UTSW 10 114,915,906 (GRCm39) missense probably damaging 1.00
R8046:Tph2 UTSW 10 115,015,499 (GRCm39) missense possibly damaging 0.62
R8738:Tph2 UTSW 10 115,015,614 (GRCm39) splice site probably benign
R9464:Tph2 UTSW 10 114,915,992 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGAGCTATTGGTGTGCCC -3'
(R):5'- CTGGAATCCTTTCGGACACTTAC -3'

Sequencing Primer
(F):5'- GTGCCCTGTGTCCTTGAAAAGC -3'
(R):5'- CGGACACTTACTTATTCCAGTGTGTG -3'
Posted On 2016-06-06