Incidental Mutation 'R5068:Usp34'
ID 388471
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 042658-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R5068 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23410665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2705 (V2705A)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129521
Predicted Effect probably benign
Transcript: ENSMUST00000130131
SMART Domains Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Pfam:UCH 171 514 1.1e-48 PFAM
Pfam:UCH_1 172 470 1.6e-25 PFAM
low complexity region 763 785 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: V2724A
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: V2724A

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148927
Predicted Effect possibly damaging
Transcript: ENSMUST00000180046
AA Change: V2705A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: V2705A

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
6030468B19Rik A G 11: 117,693,701 (GRCm39) Y56C possibly damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Add2 T A 6: 86,084,440 (GRCm39) L496Q probably damaging Het
Akt1s1 T C 7: 44,499,432 (GRCm39) probably null Het
Als2 G T 1: 59,250,433 (GRCm39) P437Q probably benign Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd17 T C 5: 90,402,667 (GRCm39) R1464G probably damaging Het
Ankrd24 T C 10: 81,475,699 (GRCm39) S121P possibly damaging Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Bnip3l T C 14: 67,237,081 (GRCm39) E57G possibly damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cc2d1b T C 4: 108,480,661 (GRCm39) V27A possibly damaging Het
Cdc37 T C 9: 21,061,099 (GRCm39) T19A probably damaging Het
Cep152 T C 2: 125,413,736 (GRCm39) I1199V probably benign Het
Chd6 G T 2: 160,808,289 (GRCm39) L1642I possibly damaging Het
Chst13 T C 6: 90,286,551 (GRCm39) E137G possibly damaging Het
Cnrip1 A G 11: 17,004,687 (GRCm39) D79G probably damaging Het
Dars2 A T 1: 160,869,483 (GRCm39) C589S probably benign Het
Dhx15 T G 5: 52,327,409 (GRCm39) I102L possibly damaging Het
Dip2a A G 10: 76,153,877 (GRCm39) L151P possibly damaging Het
Dlc1 T C 8: 37,405,184 (GRCm39) T202A probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dlgap4 T C 2: 156,549,031 (GRCm39) F464L probably benign Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Dthd1 C A 5: 62,976,059 (GRCm39) D244E probably benign Het
Dtl A T 1: 191,300,485 (GRCm39) D126E probably damaging Het
Ell2 A G 13: 75,911,737 (GRCm39) N341S probably benign Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Erbb4 A T 1: 68,083,061 (GRCm39) probably null Het
Erc2 A T 14: 28,024,900 (GRCm39) H593L possibly damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Fyn A G 10: 39,402,839 (GRCm39) K204E probably damaging Het
Gm4847 A T 1: 166,465,953 (GRCm39) F212Y possibly damaging Het
Gpc5 T C 14: 115,654,676 (GRCm39) *499R probably null Het
Hcn4 T C 9: 58,767,304 (GRCm39) L955P unknown Het
Hook2 C A 8: 85,720,028 (GRCm39) L111I possibly damaging Het
Hook3 C T 8: 26,585,785 (GRCm39) probably null Het
Hvcn1 T C 5: 122,371,544 (GRCm39) F28S probably damaging Het
Igkv6-32 A G 6: 70,051,267 (GRCm39) F30L possibly damaging Het
Inpp5b G A 4: 124,636,442 (GRCm39) probably null Het
Itgb2 G A 10: 77,384,595 (GRCm39) A239T probably damaging Het
Kcnrg T C 14: 61,845,266 (GRCm39) L102P probably damaging Het
Kif16b A T 2: 142,553,627 (GRCm39) M1068K probably benign Het
Kifc3 T C 8: 95,836,844 (GRCm39) R109G possibly damaging Het
Klhl28 A T 12: 65,004,486 (GRCm39) M9K probably benign Het
Kptn T C 7: 15,857,027 (GRCm39) Y172H probably damaging Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Mrc1 T A 2: 14,311,327 (GRCm39) M868K probably benign Het
Mterf1a T C 5: 3,941,854 (GRCm39) N5D probably benign Het
Muc5b T C 7: 141,412,345 (GRCm39) S1764P unknown Het
Myo9b T C 8: 71,801,699 (GRCm39) Y1275H probably damaging Het
Nek1 T C 8: 61,469,330 (GRCm39) I129T probably damaging Het
Net1 G A 13: 3,936,740 (GRCm39) A221V probably benign Het
Nuak2 A T 1: 132,259,509 (GRCm39) D429V probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or52h1 T A 7: 103,829,448 (GRCm39) S56C probably damaging Het
Or8b42 T C 9: 38,341,760 (GRCm39) Y61H probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdh7 T C 5: 57,879,508 (GRCm39) V1021A probably damaging Het
Pclo G C 5: 14,729,087 (GRCm39) probably benign Het
Pds5a A C 5: 65,772,615 (GRCm39) D1329E probably damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pias3 A G 3: 96,611,171 (GRCm39) K431E probably damaging Het
Piwil1 T C 5: 128,818,678 (GRCm39) S158P probably damaging Het
Plxnc1 A T 10: 94,635,239 (GRCm39) I1329N possibly damaging Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Pnpla1 T A 17: 29,098,397 (GRCm39) probably null Het
Prdm10 T C 9: 31,270,343 (GRCm39) Y827H probably damaging Het
Prss3b A C 6: 41,009,370 (GRCm39) Y155D probably benign Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rgl3 A G 9: 21,899,340 (GRCm39) probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rpp40 T C 13: 36,082,681 (GRCm39) N254D probably benign Het
Scin T A 12: 40,174,699 (GRCm39) H128L probably damaging Het
Sh3bp2 A T 5: 34,714,311 (GRCm39) M225L probably benign Het
Shisa9 C A 16: 12,085,412 (GRCm39) H324Q possibly damaging Het
Sipa1l1 A G 12: 82,484,601 (GRCm39) D1585G probably damaging Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slc6a13 T C 6: 121,310,301 (GRCm39) L320P probably damaging Het
Spats2l A G 1: 57,982,380 (GRCm39) T421A probably benign Het
Spryd3 A T 15: 102,037,046 (GRCm39) D207E probably benign Het
Srrt T C 5: 137,294,803 (GRCm39) N392S possibly damaging Het
Stk36 G T 1: 74,661,504 (GRCm39) R510S probably benign Het
Sucnr1 A G 3: 59,994,288 (GRCm39) Y272C probably damaging Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tmem131 A G 1: 36,893,986 (GRCm39) I139T probably damaging Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Tsc22d1 T C 14: 76,655,750 (GRCm39) I661T probably benign Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Uap1 G T 1: 169,989,032 (GRCm39) P130Q probably damaging Het
Ube3c T C 5: 29,806,352 (GRCm39) probably null Het
Umad1 A T 6: 8,401,157 (GRCm39) probably null Het
Vps13a T C 19: 16,723,422 (GRCm39) S259G probably benign Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wdfy3 T C 5: 102,042,803 (GRCm39) T1983A probably benign Het
Wdr24 T G 17: 26,044,753 (GRCm39) F203V possibly damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Zfp282 A C 6: 47,854,637 (GRCm39) Q11P probably benign Het
Zfp750 T A 11: 121,403,021 (GRCm39) T576S probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCCACTGGAATCTTGTTTTCG -3'
(R):5'- AACAGGCATTATCATTGGGTTACC -3'

Sequencing Primer
(F):5'- TAGTTTCAGGGGAGCTGACACC -3'
(R):5'- CCCCCACTCTCCCAAAAC -3'
Posted On 2016-06-06