Incidental Mutation 'R5069:Aff3'
ID388513
Institutional Source Beutler Lab
Gene Symbol Aff3
Ensembl Gene ENSMUSG00000037138
Gene NameAF4/FMR2 family, member 3
SynonymsLaf4, LAF-4, 3222402O04Rik
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5069 (G1)
Quality Score204
Status Not validated
Chromosome1
Chromosomal Location38177326-38664955 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 38181613 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039827] [ENSMUST00000039827] [ENSMUST00000095027] [ENSMUST00000095027]
Predicted Effect probably null
Transcript: ENSMUST00000039827
SMART Domains Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 170 4.9e-63 PFAM
Pfam:AF-4 160 1226 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039827
SMART Domains Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 170 4.9e-63 PFAM
Pfam:AF-4 160 1226 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095027
SMART Domains Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 172 1.7e-47 PFAM
Pfam:AF-4 161 1226 3.8e-268 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095027
SMART Domains Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 172 1.7e-47 PFAM
Pfam:AF-4 161 1226 3.8e-268 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136641
SMART Domains Protein: ENSMUSP00000114638
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 1 253 1.8e-118 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Aff3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Aff3 APN 1 38535681 missense probably damaging 1.00
IGL02263:Aff3 APN 1 38535599 missense probably damaging 1.00
IGL02962:Aff3 APN 1 38535656 missense probably damaging 1.00
IGL03003:Aff3 APN 1 38209570 missense probably damaging 1.00
IGL03180:Aff3 APN 1 38535662 missense probably damaging 1.00
IGL03389:Aff3 APN 1 38210349 missense possibly damaging 0.62
PIT4377001:Aff3 UTSW 1 38538963 missense probably damaging 0.99
PIT4544001:Aff3 UTSW 1 38210362 missense probably benign 0.01
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0026:Aff3 UTSW 1 38203893 missense probably benign 0.00
R0279:Aff3 UTSW 1 38535569 missense probably damaging 1.00
R0344:Aff3 UTSW 1 38203932 missense probably benign
R0375:Aff3 UTSW 1 38204940 missense possibly damaging 0.46
R0605:Aff3 UTSW 1 38209987 missense probably damaging 1.00
R0613:Aff3 UTSW 1 38209923 missense probably benign 0.09
R0742:Aff3 UTSW 1 38627108 missense probably damaging 0.99
R1156:Aff3 UTSW 1 38204910 missense probably benign
R1255:Aff3 UTSW 1 38204884 splice site probably null
R1448:Aff3 UTSW 1 38191283 missense probably damaging 1.00
R1760:Aff3 UTSW 1 38329864 splice site probably benign
R1780:Aff3 UTSW 1 38535702 missense probably damaging 1.00
R1855:Aff3 UTSW 1 38210304 missense probably benign 0.23
R2011:Aff3 UTSW 1 38207915 missense probably benign 0.01
R2331:Aff3 UTSW 1 38204890 splice site probably null
R2965:Aff3 UTSW 1 38209710 missense probably damaging 1.00
R2970:Aff3 UTSW 1 38535022 missense probably damaging 0.97
R3015:Aff3 UTSW 1 38210568 missense probably benign 0.00
R3763:Aff3 UTSW 1 38252689 splice site probably benign
R4174:Aff3 UTSW 1 38207927 missense probably damaging 0.96
R4436:Aff3 UTSW 1 38209687 missense possibly damaging 0.75
R4661:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R5566:Aff3 UTSW 1 38181424 missense probably damaging 1.00
R6023:Aff3 UTSW 1 38218370 missense probably damaging 1.00
R6209:Aff3 UTSW 1 38193589 missense probably benign 0.28
R6467:Aff3 UTSW 1 38208017 missense probably benign 0.25
R6748:Aff3 UTSW 1 38535246 missense probably damaging 1.00
R6862:Aff3 UTSW 1 38406497 missense possibly damaging 0.87
R6880:Aff3 UTSW 1 38535162 missense probably damaging 0.99
R6880:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R7187:Aff3 UTSW 1 38218397 missense probably damaging 0.98
R8322:Aff3 UTSW 1 38181661 missense possibly damaging 0.65
R8329:Aff3 UTSW 1 38205054 missense probably benign 0.13
R8737:Aff3 UTSW 1 38269729 missense probably damaging 1.00
Z1176:Aff3 UTSW 1 38329872 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCTGACGATGGTCGATG -3'
(R):5'- ATCTGTTCTCAGTGAGTCTGC -3'

Sequencing Primer
(F):5'- CTGACGATGGTCGATGGGGAC -3'
(R):5'- AGTGAGTCTGCGCTGACCTAC -3'
Posted On2016-06-06