Mutagenetix > Incidental Mutations

Incidental Mutation 'R5069:Slc11a1'

388515

Institutional Source

Beutler Lab

Gene Symbol

Slc11a1

Ensembl Gene

ENSMUSG00000026177

Gene Name

solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1

Synonyms

host resistance locus Bcg/Ity/Lsh, Nramp, ity, Lsh, Ity, Bcg, Nramp1

MMRRC Submission

042659-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74375195-74386062 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74385184 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 434 (A434T)

Ref Sequence

ENSEMBL: ENSMUSP00000139455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027368] [ENSMUST00000187516]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027368
AA Change: A475T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027368
Gene: ENSMUSG00000026177
AA Change: A475T

Domain	Start	End	E-Value	Type
Pfam:Nramp	75	460	1.5e-119	PFAM
transmembrane domain	464	486	N/A	INTRINSIC
transmembrane domain	491	513	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127487

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133896

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134189

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136786

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147233

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149166

Predicted Effect

probably damaging
Transcript: ENSMUST00000187516
AA Change: A434T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139455
Gene: ENSMUSG00000026177
AA Change: A434T

Domain	Start	End	E-Value	Type
Pfam:Nramp	46	419	1.4e-109	PFAM
transmembrane domain	423	445	N/A	INTRINSIC
transmembrane domain	450	472	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene are associated with susceptibility to infection with pathogens, including Myobacterium, Salmonella and Leishmania. Depending on the mutation, mutants may exhibit either increased or decreased susceptibility to infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Slc11a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Slc11a1	APN	1	74381898	splice site	probably null
IGL00813:Slc11a1	APN	1	74383480	missense	probably benign	0.03
IGL00970:Slc11a1	APN	1	74380662	missense	probably damaging	1.00
IGL01017:Slc11a1	APN	1	74379796	missense	probably damaging	1.00
IGL01646:Slc11a1	APN	1	74384740	missense	probably damaging	0.99
IGL01941:Slc11a1	APN	1	74377179	missense	probably damaging	1.00
IGL01996:Slc11a1	APN	1	74376806	missense	possibly damaging	0.93
IGL02580:Slc11a1	APN	1	74380259	missense	probably damaging	0.99
IGL02586:Slc11a1	APN	1	74385132	splice site	probably benign
IGL02961:Slc11a1	APN	1	74377173	missense	probably damaging	1.00
R1813:Slc11a1	UTSW	1	74375772	missense	probably benign
R1896:Slc11a1	UTSW	1	74375772	missense	probably benign
R2219:Slc11a1	UTSW	1	74380665	missense	probably damaging	0.98
R2220:Slc11a1	UTSW	1	74380665	missense	probably damaging	0.98
R2416:Slc11a1	UTSW	1	74383644	missense	probably damaging	0.96
R2432:Slc11a1	UTSW	1	74383751	splice site	probably benign
R3893:Slc11a1	UTSW	1	74384706	missense	probably damaging	1.00
R4450:Slc11a1	UTSW	1	74385535	utr 3 prime	probably benign
R4638:Slc11a1	UTSW	1	74375278	start gained	probably benign
R4782:Slc11a1	UTSW	1	74384088	missense	probably damaging	0.98
R5068:Slc11a1	UTSW	1	74385184	missense	probably damaging	1.00
R5070:Slc11a1	UTSW	1	74385184	missense	probably damaging	1.00
R5215:Slc11a1	UTSW	1	74383777	intron	probably benign
R5333:Slc11a1	UTSW	1	74384145	missense	probably damaging	1.00
R5613:Slc11a1	UTSW	1	74380906	missense	probably damaging	1.00
R5621:Slc11a1	UTSW	1	74380906	missense	probably damaging	1.00
R5622:Slc11a1	UTSW	1	74380906	missense	probably damaging	1.00
R5950:Slc11a1	UTSW	1	74377176	missense	probably benign	0.40
R6239:Slc11a1	UTSW	1	74384115	missense	possibly damaging	0.82
R6776:Slc11a1	UTSW	1	74384085	missense	probably damaging	1.00
R7199:Slc11a1	UTSW	1	74383671	missense	possibly damaging	0.83
R7356:Slc11a1	UTSW	1	74385489	missense	probably benign
R8142:Slc11a1	UTSW	1	74385259	missense	probably benign
R8877:Slc11a1	UTSW	1	74380265	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTAACTGGGTCTATCTGCTC -3'
(R):5'- GCCCATATAAGAAGTGCTTGTGG -3'

Sequencing Primer
(F):5'- TCTAGAGCATTCAGGCAGTCC -3'
(R):5'- ATGCAACAGGTCCAGGC -3'

Posted On

2016-06-06