Incidental Mutation 'R5069:Rtel1'
ID388524
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Nameregulator of telomere elongation helicase 1
SynonymsNhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission 042659-MU
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181319739-181356616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181355492 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1042 (V1042M)
Ref Sequence ENSEMBL: ENSMUSP00000096571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108808] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000127988] [ENSMUST00000148252] [ENSMUST00000183499] [ENSMUST00000170190] [ENSMUST00000185118]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048269
Predicted Effect probably benign
Transcript: ENSMUST00000048608
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054622
AA Change: V1081M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: V1081M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098971
AA Change: V1042M

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: V1042M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108808
SMART Domains Protein: ENSMUSP00000104436
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108814
AA Change: V1075M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: V1075M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108815
AA Change: V1036M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: V1036M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124149
Predicted Effect probably benign
Transcript: ENSMUST00000127988
SMART Domains Protein: ENSMUSP00000122066
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147266
Predicted Effect probably benign
Transcript: ENSMUST00000148252
AA Change: V864M

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: V864M

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152580
Predicted Effect probably benign
Transcript: ENSMUST00000137700
Predicted Effect probably benign
Transcript: ENSMUST00000183499
SMART Domains Protein: ENSMUSP00000138941
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 61 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134651
Predicted Effect probably benign
Transcript: ENSMUST00000170190
SMART Domains Protein: ENSMUSP00000126387
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Miro 1 90 1.2e-9 PFAM
Pfam:Arf 1 140 8.5e-38 PFAM
Pfam:Gtr1_RagA 2 110 2.2e-6 PFAM
Pfam:SRPRB 4 118 6e-8 PFAM
Pfam:Ras 4 142 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185118
SMART Domains Protein: ENSMUSP00000139211
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 120 1.6e-30 PFAM
Pfam:SRPRB 15 116 6.6e-8 PFAM
Pfam:Ras 19 116 2.1e-9 PFAM
Pfam:Miro 19 117 7.3e-12 PFAM
Pfam:MMR_HSR1 19 117 1.2e-7 PFAM
Pfam:Gtr1_RagA 19 119 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133856
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 splice site probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7523:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense probably damaging 1.00
R8062:Rtel1 UTSW 2 181340567 missense probably benign 0.17
R8088:Rtel1 UTSW 2 181322345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCCAAGCCATTTGACAC -3'
(R):5'- AACATGCCAAATCCTGTGGG -3'

Sequencing Primer
(F):5'- GCTCATTTTTCCAAACCAGGAC -3'
(R):5'- GGGAAACTTCTGCTCAAGCTCTG -3'
Posted On2016-06-06