Incidental Mutation 'R5069:Rtel1'
ID 388524
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Name regulator of telomere elongation helicase 1
Synonyms
MMRRC Submission 042659-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5069 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 180961532-180998409 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 180997285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1042 (V1042M)
Ref Sequence ENSEMBL: ENSMUSP00000096571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108808] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000127988] [ENSMUST00000148252] [ENSMUST00000183499] [ENSMUST00000170190] [ENSMUST00000185118]
AlphaFold Q0VGM9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048269
Predicted Effect probably benign
Transcript: ENSMUST00000048608
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054622
AA Change: V1081M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: V1081M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098971
AA Change: V1042M

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: V1042M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108808
SMART Domains Protein: ENSMUSP00000104436
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108814
AA Change: V1075M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: V1075M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108815
AA Change: V1036M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: V1036M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124149
Predicted Effect probably benign
Transcript: ENSMUST00000127988
SMART Domains Protein: ENSMUSP00000122066
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147266
Predicted Effect probably benign
Transcript: ENSMUST00000148252
AA Change: V864M

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: V864M

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152580
Predicted Effect probably benign
Transcript: ENSMUST00000137700
Predicted Effect probably benign
Transcript: ENSMUST00000183499
SMART Domains Protein: ENSMUSP00000138941
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 61 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134651
Predicted Effect probably benign
Transcript: ENSMUST00000170190
SMART Domains Protein: ENSMUSP00000126387
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Miro 1 90 1.2e-9 PFAM
Pfam:Arf 1 140 8.5e-38 PFAM
Pfam:Gtr1_RagA 2 110 2.2e-6 PFAM
Pfam:SRPRB 4 118 6e-8 PFAM
Pfam:Ras 4 142 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185118
SMART Domains Protein: ENSMUSP00000139211
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 120 1.6e-30 PFAM
Pfam:SRPRB 15 116 6.6e-8 PFAM
Pfam:Ras 19 116 2.1e-9 PFAM
Pfam:Miro 19 117 7.3e-12 PFAM
Pfam:MMR_HSR1 19 117 1.2e-7 PFAM
Pfam:Gtr1_RagA 19 119 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133856
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
AAdacl4fm3 T A 4: 144,430,437 (GRCm39) D184V probably damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Adcy7 T C 8: 89,054,325 (GRCm39) L1060P probably damaging Het
Aff3 A G 1: 38,220,694 (GRCm39) probably null Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd27 A T 7: 35,327,860 (GRCm39) K793N probably damaging Het
Arhgef28 T C 13: 98,211,714 (GRCm39) T90A probably damaging Het
Armc9 A T 1: 86,184,959 (GRCm39) H670L probably benign Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Ass1 C T 2: 31,400,185 (GRCm39) T301M probably damaging Het
Baiap3 A T 17: 25,468,082 (GRCm39) C283S probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cdh3 A G 8: 107,263,458 (GRCm39) N126S probably benign Het
Cfap54 A C 10: 92,773,636 (GRCm39) F135L probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Elapor2 T A 5: 9,490,897 (GRCm39) C636S probably damaging Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Firrm T C 1: 163,815,243 (GRCm39) T93A possibly damaging Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gm1043 T G 5: 37,344,580 (GRCm39) L231R probably damaging Het
Gpr153 T A 4: 152,364,340 (GRCm39) M132K probably damaging Het
Hbs1l T A 10: 21,230,546 (GRCm39) S496T probably damaging Het
Inpp5f A G 7: 128,278,451 (GRCm39) probably null Het
Kat6a G A 8: 23,393,149 (GRCm39) C209Y probably damaging Het
Kcna2 T A 3: 107,011,953 (GRCm39) V178D probably damaging Het
Krt75 A G 15: 101,474,673 (GRCm39) probably null Het
Letm2 G A 8: 26,083,980 (GRCm39) Q84* probably null Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Muc6 A G 7: 141,237,564 (GRCm39) C218R probably damaging Het
Myof A T 19: 37,893,773 (GRCm39) I1130N possibly damaging Het
Neil3 A G 8: 54,054,076 (GRCm39) S318P possibly damaging Het
Nhlh1 A G 1: 171,881,467 (GRCm39) V133A probably benign Het
Nup153 A C 13: 46,863,268 (GRCm39) S331A probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or9s23 T A 1: 92,501,135 (GRCm39) S81T probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pald1 A T 10: 61,177,025 (GRCm39) M675K possibly damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pitpnm1 C T 19: 4,161,140 (GRCm39) A897V probably benign Het
Plxnd1 A T 6: 115,942,862 (GRCm39) V1274E probably damaging Het
Polr2a T C 11: 69,627,561 (GRCm39) probably null Het
Ppfia1 G A 7: 144,068,210 (GRCm39) Q446* probably null Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rhbdl2 T A 4: 123,711,710 (GRCm39) L149* probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Sidt2 A T 9: 45,850,759 (GRCm39) probably null Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc28a2b A T 2: 122,324,854 (GRCm39) N142I possibly damaging Het
Slc4a10 G A 2: 62,097,915 (GRCm39) R508H probably benign Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slf2 T A 19: 44,923,692 (GRCm39) S169T possibly damaging Het
Snx33 A T 9: 56,833,475 (GRCm39) I198N probably damaging Het
Spock3 A G 8: 63,808,299 (GRCm39) T396A probably benign Het
Sva A T 6: 42,015,351 (GRCm39) probably benign Het
Syt7 A G 19: 10,416,601 (GRCm39) N261S probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Thoc2 C T X: 40,895,570 (GRCm39) E1491K probably damaging Het
Tlr1 T C 5: 65,083,743 (GRCm39) Y278C probably benign Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Trpm4 T G 7: 44,959,893 (GRCm39) Y667S probably damaging Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Ube4a T C 9: 44,851,387 (GRCm39) H709R probably damaging Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wars2 A G 3: 99,094,849 (GRCm39) H48R probably damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 180,996,194 (GRCm39) missense probably benign 0.16
IGL01957:Rtel1 APN 2 180,991,106 (GRCm39) unclassified probably benign
IGL02247:Rtel1 APN 2 180,993,134 (GRCm39) nonsense probably null
IGL02414:Rtel1 APN 2 180,977,765 (GRCm39) missense probably benign 0.01
IGL02448:Rtel1 APN 2 180,977,830 (GRCm39) missense probably benign 0.00
IGL03053:Rtel1 APN 2 180,993,737 (GRCm39) missense probably benign 0.02
IGL03059:Rtel1 APN 2 180,991,976 (GRCm39) missense probably benign 0.01
IGL03326:Rtel1 APN 2 180,997,354 (GRCm39) unclassified probably benign
PIT4283001:Rtel1 UTSW 2 180,988,683 (GRCm39) missense probably benign 0.00
R0047:Rtel1 UTSW 2 180,965,198 (GRCm39) missense probably damaging 1.00
R0047:Rtel1 UTSW 2 180,965,198 (GRCm39) missense probably damaging 1.00
R0051:Rtel1 UTSW 2 180,992,449 (GRCm39) nonsense probably null
R0051:Rtel1 UTSW 2 180,992,449 (GRCm39) nonsense probably null
R0147:Rtel1 UTSW 2 180,962,839 (GRCm39) missense probably damaging 1.00
R0148:Rtel1 UTSW 2 180,962,839 (GRCm39) missense probably damaging 1.00
R0316:Rtel1 UTSW 2 180,997,795 (GRCm39) missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 180,993,674 (GRCm39) missense probably benign 0.03
R0940:Rtel1 UTSW 2 180,964,596 (GRCm39) missense probably benign 0.36
R1165:Rtel1 UTSW 2 180,976,732 (GRCm39) missense probably benign 0.26
R1213:Rtel1 UTSW 2 180,993,128 (GRCm39) missense probably benign 0.01
R1291:Rtel1 UTSW 2 180,992,836 (GRCm39) missense probably damaging 1.00
R1353:Rtel1 UTSW 2 180,991,024 (GRCm39) missense probably benign
R1398:Rtel1 UTSW 2 180,977,658 (GRCm39) splice site probably null
R1796:Rtel1 UTSW 2 180,993,896 (GRCm39) missense probably benign 0.01
R1973:Rtel1 UTSW 2 180,993,419 (GRCm39) missense probably benign 0.04
R2033:Rtel1 UTSW 2 180,993,656 (GRCm39) nonsense probably null
R2144:Rtel1 UTSW 2 180,965,499 (GRCm39) missense probably damaging 0.97
R2265:Rtel1 UTSW 2 180,996,161 (GRCm39) missense probably damaging 1.00
R2269:Rtel1 UTSW 2 180,977,796 (GRCm39) missense probably benign 0.00
R2416:Rtel1 UTSW 2 180,982,324 (GRCm39) missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 180,991,765 (GRCm39) missense probably benign 0.36
R3508:Rtel1 UTSW 2 180,964,202 (GRCm39) missense probably benign 0.32
R4242:Rtel1 UTSW 2 180,991,727 (GRCm39) missense probably damaging 1.00
R4377:Rtel1 UTSW 2 180,997,589 (GRCm39) missense probably damaging 1.00
R4702:Rtel1 UTSW 2 180,993,962 (GRCm39) missense probably benign 0.30
R4706:Rtel1 UTSW 2 180,965,539 (GRCm39) critical splice donor site probably null
R4817:Rtel1 UTSW 2 180,997,728 (GRCm39) missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 180,964,307 (GRCm39) splice site probably null
R5222:Rtel1 UTSW 2 180,988,776 (GRCm39) intron probably benign
R5268:Rtel1 UTSW 2 180,982,354 (GRCm39) missense probably benign 0.03
R5291:Rtel1 UTSW 2 180,993,888 (GRCm39) missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 180,993,893 (GRCm39) missense probably benign
R5682:Rtel1 UTSW 2 180,991,765 (GRCm39) missense probably benign 0.19
R5796:Rtel1 UTSW 2 180,982,299 (GRCm39) missense probably benign 0.26
R5931:Rtel1 UTSW 2 180,972,608 (GRCm39) nonsense probably null
R6249:Rtel1 UTSW 2 180,993,475 (GRCm39) missense probably damaging 1.00
R6465:Rtel1 UTSW 2 180,977,733 (GRCm39) missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 180,994,579 (GRCm39) missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 180,964,256 (GRCm39) missense probably benign 0.31
R6835:Rtel1 UTSW 2 180,997,746 (GRCm39) missense probably benign 0.04
R6917:Rtel1 UTSW 2 180,980,070 (GRCm39) makesense probably null
R7264:Rtel1 UTSW 2 180,993,654 (GRCm39) missense not run
R7381:Rtel1 UTSW 2 180,972,608 (GRCm39) nonsense probably null
R7523:Rtel1 UTSW 2 180,964,108 (GRCm39) missense probably damaging 1.00
R7587:Rtel1 UTSW 2 180,964,108 (GRCm39) missense probably damaging 1.00
R7681:Rtel1 UTSW 2 180,964,187 (GRCm39) missense probably damaging 0.99
R7871:Rtel1 UTSW 2 180,962,822 (GRCm39) missense probably damaging 1.00
R7912:Rtel1 UTSW 2 180,997,869 (GRCm39) missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 180,976,767 (GRCm39) missense probably damaging 1.00
R8062:Rtel1 UTSW 2 180,982,360 (GRCm39) missense probably benign 0.17
R8088:Rtel1 UTSW 2 180,964,138 (GRCm39) missense probably damaging 1.00
R8435:Rtel1 UTSW 2 180,995,897 (GRCm39) missense possibly damaging 0.93
R8873:Rtel1 UTSW 2 180,997,816 (GRCm39) frame shift probably null
R9441:Rtel1 UTSW 2 180,988,860 (GRCm39) missense possibly damaging 0.89
R9704:Rtel1 UTSW 2 180,993,905 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTCCCAAGCCATTTGACAC -3'
(R):5'- AACATGCCAAATCCTGTGGG -3'

Sequencing Primer
(F):5'- GCTCATTTTTCCAAACCAGGAC -3'
(R):5'- GGGAAACTTCTGCTCAAGCTCTG -3'
Posted On 2016-06-06