Mutagenetix > Incidental Mutation

Incidental Mutation 'R5069:Rtel1'

388524

Institutional Source

Beutler Lab

Gene Symbol

Rtel1

Ensembl Gene

ENSMUSG00000038685

Gene Name

regulator of telomere elongation helicase 1

Synonyms

Nhl, Rtel, KIAA1088, C20ORF41

MMRRC Submission

042659-MU

Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

181319739-181356616 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 181355492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1042 (V1042M)

Ref Sequence

ENSEMBL: ENSMUSP00000096571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108808] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000127988] [ENSMUST00000148252] [ENSMUST00000183499] [ENSMUST00000170190] [ENSMUST00000185118]

AlphaFold

Q0VGM9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000048269

Predicted Effect

probably benign
Transcript: ENSMUST00000048608

SMART Domains

Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000054622
AA Change: V1081M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: V1081M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1075	1092	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098971
AA Change: V1042M

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: V1042M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1036	1053	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108808

SMART Domains

Protein: ENSMUSP00000104436
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
ARF	1	191	1.71e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108814
AA Change: V1075M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: V1075M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1069	1086	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108815
AA Change: V1036M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: V1036M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1030	1047	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124149

Predicted Effect

probably benign
Transcript: ENSMUST00000127988

SMART Domains

Protein: ENSMUSP00000122066
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
ARF	1	191	1.71e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130346

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130772

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130935

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139601

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147266

Predicted Effect

probably benign
Transcript: ENSMUST00000148252
AA Change: V864M

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: V864M

Domain	Start	End	E-Value	Type
Pfam:DEAD_2	1	88	1.3e-33	PFAM
HELICc	379	533	1.07e-62	SMART
low complexity region	858	875	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144648

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152580

Predicted Effect

probably benign
Transcript: ENSMUST00000137700

Predicted Effect

probably benign
Transcript: ENSMUST00000183499

SMART Domains

Protein: ENSMUSP00000138941
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
Pfam:Arf	4	61	4.8e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134651

Predicted Effect

probably benign
Transcript: ENSMUST00000170190

SMART Domains

Protein: ENSMUSP00000126387
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
Pfam:Miro	1	90	1.2e-9	PFAM
Pfam:Arf	1	140	8.5e-38	PFAM
Pfam:Gtr1_RagA	2	110	2.2e-6	PFAM
Pfam:SRPRB	4	118	6e-8	PFAM
Pfam:Ras	4	142	2.7e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000185118

SMART Domains

Protein: ENSMUSP00000139211
Gene: ENSMUSG00000038671

Domain	Start	End	E-Value	Type
Pfam:Arf	4	120	1.6e-30	PFAM
Pfam:SRPRB	15	116	6.6e-8	PFAM
Pfam:Ras	19	116	2.1e-9	PFAM
Pfam:Miro	19	117	7.3e-12	PFAM
Pfam:MMR_HSR1	19	117	1.2e-7	PFAM
Pfam:Gtr1_RagA	19	119	5.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133856

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Rtel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Rtel1	APN	2	181354401	missense	probably benign	0.16
IGL01957:Rtel1	APN	2	181349313	unclassified	probably benign
IGL02247:Rtel1	APN	2	181351341	nonsense	probably null
IGL02414:Rtel1	APN	2	181335972	missense	probably benign	0.01
IGL02448:Rtel1	APN	2	181336037	missense	probably benign	0.00
IGL03053:Rtel1	APN	2	181351944	missense	probably benign	0.02
IGL03059:Rtel1	APN	2	181350183	missense	probably benign	0.01
IGL03326:Rtel1	APN	2	181355561	unclassified	probably benign
PIT4283001:Rtel1	UTSW	2	181346890	missense	probably benign	0.00
R0047:Rtel1	UTSW	2	181323405	missense	probably damaging	1.00
R0047:Rtel1	UTSW	2	181323405	missense	probably damaging	1.00
R0051:Rtel1	UTSW	2	181350656	nonsense	probably null
R0051:Rtel1	UTSW	2	181350656	nonsense	probably null
R0147:Rtel1	UTSW	2	181321046	missense	probably damaging	1.00
R0148:Rtel1	UTSW	2	181321046	missense	probably damaging	1.00
R0316:Rtel1	UTSW	2	181356002	missense	possibly damaging	0.87
R0628:Rtel1	UTSW	2	181351881	missense	probably benign	0.03
R0940:Rtel1	UTSW	2	181322803	missense	probably benign	0.36
R1165:Rtel1	UTSW	2	181334939	missense	probably benign	0.26
R1213:Rtel1	UTSW	2	181351335	missense	probably benign	0.01
R1291:Rtel1	UTSW	2	181351043	missense	probably damaging	1.00
R1353:Rtel1	UTSW	2	181349231	missense	probably benign
R1398:Rtel1	UTSW	2	181335865	splice site	probably null
R1796:Rtel1	UTSW	2	181352103	missense	probably benign	0.01
R1973:Rtel1	UTSW	2	181351626	missense	probably benign	0.04
R2033:Rtel1	UTSW	2	181351863	nonsense	probably null
R2144:Rtel1	UTSW	2	181323706	missense	probably damaging	0.97
R2265:Rtel1	UTSW	2	181354368	missense	probably damaging	1.00
R2269:Rtel1	UTSW	2	181336003	missense	probably benign	0.00
R2416:Rtel1	UTSW	2	181340531	missense	possibly damaging	0.66
R2865:Rtel1	UTSW	2	181349972	missense	probably benign	0.36
R3508:Rtel1	UTSW	2	181322409	missense	probably benign	0.32
R4242:Rtel1	UTSW	2	181349934	missense	probably damaging	1.00
R4377:Rtel1	UTSW	2	181355796	missense	probably damaging	1.00
R4702:Rtel1	UTSW	2	181352169	missense	probably benign	0.30
R4706:Rtel1	UTSW	2	181323746	critical splice donor site	probably null
R4817:Rtel1	UTSW	2	181355935	missense	possibly damaging	0.82
R5020:Rtel1	UTSW	2	181322514	splice site	probably null
R5222:Rtel1	UTSW	2	181346983	intron	probably benign
R5268:Rtel1	UTSW	2	181340561	missense	probably benign	0.03
R5291:Rtel1	UTSW	2	181352095	missense	possibly damaging	0.47
R5588:Rtel1	UTSW	2	181352100	missense	probably benign
R5682:Rtel1	UTSW	2	181349972	missense	probably benign	0.19
R5796:Rtel1	UTSW	2	181340506	missense	probably benign	0.26
R5931:Rtel1	UTSW	2	181330815	nonsense	probably null
R6249:Rtel1	UTSW	2	181351682	missense	probably damaging	1.00
R6465:Rtel1	UTSW	2	181335940	missense	possibly damaging	0.68
R6616:Rtel1	UTSW	2	181352786	missense	possibly damaging	0.68
R6800:Rtel1	UTSW	2	181322463	missense	probably benign	0.31
R6835:Rtel1	UTSW	2	181355953	missense	probably benign	0.04
R6917:Rtel1	UTSW	2	181338277	makesense	probably null
R7264:Rtel1	UTSW	2	181351861	missense	not run
R7381:Rtel1	UTSW	2	181330815	nonsense	probably null
R7523:Rtel1	UTSW	2	181322315	missense	probably damaging	1.00
R7587:Rtel1	UTSW	2	181322315	missense	probably damaging	1.00
R7681:Rtel1	UTSW	2	181322394	missense	probably damaging	0.99
R7871:Rtel1	UTSW	2	181321029	missense	probably damaging	1.00
R7912:Rtel1	UTSW	2	181356076	missense	possibly damaging	0.56
R8007:Rtel1	UTSW	2	181334974	missense	probably damaging	1.00
R8062:Rtel1	UTSW	2	181340567	missense	probably benign	0.17
R8088:Rtel1	UTSW	2	181322345	missense	probably damaging	1.00
R8435:Rtel1	UTSW	2	181354104	missense	possibly damaging	0.93
R8873:Rtel1	UTSW	2	181356023	frame shift	probably null
R9441:Rtel1	UTSW	2	181347067	missense	possibly damaging	0.89
R9704:Rtel1	UTSW	2	181352112	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGTCCCAAGCCATTTGACAC -3'
(R):5'- AACATGCCAAATCCTGTGGG -3'

Sequencing Primer
(F):5'- GCTCATTTTTCCAAACCAGGAC -3'
(R):5'- GGGAAACTTCTGCTCAAGCTCTG -3'

Posted On

2016-06-06