Incidental Mutation 'R5069:Wars2'
ID 388525
Institutional Source Beutler Lab
Gene Symbol Wars2
Ensembl Gene ENSMUSG00000004233
Gene Name tryptophanyl tRNA synthetase 2 (mitochondrial)
Synonyms TrpRS, 9430020O07Rik
MMRRC Submission 042659-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5069 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99047423-99128546 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99094849 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 48 (H48R)
Ref Sequence ENSEMBL: ENSMUSP00000142723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004343] [ENSMUST00000135960] [ENSMUST00000145650] [ENSMUST00000198044]
AlphaFold Q9CYK1
Predicted Effect probably damaging
Transcript: ENSMUST00000004343
AA Change: H48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004343
Gene: ENSMUSG00000004233
AA Change: H48R

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 30 315 2.7e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126875
Predicted Effect probably damaging
Transcript: ENSMUST00000135960
AA Change: H48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142470
Gene: ENSMUSG00000004233
AA Change: H48R

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 30 175 1e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145650
AA Change: H48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142723
Gene: ENSMUSG00000004233
AA Change: H48R

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 30 178 1.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198044
SMART Domains Protein: ENSMUSP00000142361
Gene: ENSMUSG00000004233

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 25 92 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. This gene encodes the mitochondrial tryptophanyl-tRNA synthetase. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit decreased body fat mass, cardiomyopathy, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
AAdacl4fm3 T A 4: 144,430,437 (GRCm39) D184V probably damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Adcy7 T C 8: 89,054,325 (GRCm39) L1060P probably damaging Het
Aff3 A G 1: 38,220,694 (GRCm39) probably null Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd27 A T 7: 35,327,860 (GRCm39) K793N probably damaging Het
Arhgef28 T C 13: 98,211,714 (GRCm39) T90A probably damaging Het
Armc9 A T 1: 86,184,959 (GRCm39) H670L probably benign Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Ass1 C T 2: 31,400,185 (GRCm39) T301M probably damaging Het
Baiap3 A T 17: 25,468,082 (GRCm39) C283S probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cdh3 A G 8: 107,263,458 (GRCm39) N126S probably benign Het
Cfap54 A C 10: 92,773,636 (GRCm39) F135L probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Elapor2 T A 5: 9,490,897 (GRCm39) C636S probably damaging Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Firrm T C 1: 163,815,243 (GRCm39) T93A possibly damaging Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gm1043 T G 5: 37,344,580 (GRCm39) L231R probably damaging Het
Gpr153 T A 4: 152,364,340 (GRCm39) M132K probably damaging Het
Hbs1l T A 10: 21,230,546 (GRCm39) S496T probably damaging Het
Inpp5f A G 7: 128,278,451 (GRCm39) probably null Het
Kat6a G A 8: 23,393,149 (GRCm39) C209Y probably damaging Het
Kcna2 T A 3: 107,011,953 (GRCm39) V178D probably damaging Het
Krt75 A G 15: 101,474,673 (GRCm39) probably null Het
Letm2 G A 8: 26,083,980 (GRCm39) Q84* probably null Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Muc6 A G 7: 141,237,564 (GRCm39) C218R probably damaging Het
Myof A T 19: 37,893,773 (GRCm39) I1130N possibly damaging Het
Neil3 A G 8: 54,054,076 (GRCm39) S318P possibly damaging Het
Nhlh1 A G 1: 171,881,467 (GRCm39) V133A probably benign Het
Nup153 A C 13: 46,863,268 (GRCm39) S331A probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or9s23 T A 1: 92,501,135 (GRCm39) S81T probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pald1 A T 10: 61,177,025 (GRCm39) M675K possibly damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pitpnm1 C T 19: 4,161,140 (GRCm39) A897V probably benign Het
Plxnd1 A T 6: 115,942,862 (GRCm39) V1274E probably damaging Het
Polr2a T C 11: 69,627,561 (GRCm39) probably null Het
Ppfia1 G A 7: 144,068,210 (GRCm39) Q446* probably null Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rhbdl2 T A 4: 123,711,710 (GRCm39) L149* probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rtel1 G A 2: 180,997,285 (GRCm39) V1042M probably benign Het
Sidt2 A T 9: 45,850,759 (GRCm39) probably null Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc28a2b A T 2: 122,324,854 (GRCm39) N142I possibly damaging Het
Slc4a10 G A 2: 62,097,915 (GRCm39) R508H probably benign Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slf2 T A 19: 44,923,692 (GRCm39) S169T possibly damaging Het
Snx33 A T 9: 56,833,475 (GRCm39) I198N probably damaging Het
Spock3 A G 8: 63,808,299 (GRCm39) T396A probably benign Het
Sva A T 6: 42,015,351 (GRCm39) probably benign Het
Syt7 A G 19: 10,416,601 (GRCm39) N261S probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Thoc2 C T X: 40,895,570 (GRCm39) E1491K probably damaging Het
Tlr1 T C 5: 65,083,743 (GRCm39) Y278C probably benign Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Trpm4 T G 7: 44,959,893 (GRCm39) Y667S probably damaging Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Ube4a T C 9: 44,851,387 (GRCm39) H709R probably damaging Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Other mutations in Wars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Wars2 UTSW 3 99,214,774 (GRCm38) frame shift probably null
PIT4449001:Wars2 UTSW 3 99,112,595 (GRCm39) missense possibly damaging 0.90
R0511:Wars2 UTSW 3 99,123,865 (GRCm39) missense probably damaging 1.00
R0748:Wars2 UTSW 3 99,123,888 (GRCm39) missense probably damaging 1.00
R1446:Wars2 UTSW 3 99,094,843 (GRCm39) missense probably benign 0.12
R1534:Wars2 UTSW 3 99,124,177 (GRCm39) missense probably damaging 1.00
R2118:Wars2 UTSW 3 99,123,883 (GRCm39) missense probably benign 0.06
R4246:Wars2 UTSW 3 99,123,904 (GRCm39) missense probably damaging 0.99
R5973:Wars2 UTSW 3 99,094,962 (GRCm39) missense probably benign
R6518:Wars2 UTSW 3 99,124,116 (GRCm39) missense probably benign
R7098:Wars2 UTSW 3 99,123,957 (GRCm39) missense probably damaging 1.00
R8010:Wars2 UTSW 3 99,124,146 (GRCm39) missense probably benign 0.01
R8247:Wars2 UTSW 3 99,094,965 (GRCm39) missense probably benign 0.00
R8794:Wars2 UTSW 3 99,123,888 (GRCm39) missense probably damaging 1.00
R9087:Wars2 UTSW 3 99,124,063 (GRCm39) missense possibly damaging 0.84
R9341:Wars2 UTSW 3 99,094,846 (GRCm39) missense probably benign
R9343:Wars2 UTSW 3 99,094,846 (GRCm39) missense probably benign
R9528:Wars2 UTSW 3 99,111,922 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCTCATACACTTTGGGGTTAAG -3'
(R):5'- TTCTCTGGGTTTATGCCACAGG -3'

Sequencing Primer
(F):5'- AATACCCCTTTGTGTCTAACAGAGC -3'
(R):5'- GCAAGAAGCACAGCAGTCATGTC -3'
Posted On 2016-06-06