Incidental Mutation 'R5069:Kcna2'
ID 388526
Institutional Source Beutler Lab
Gene Symbol Kcna2
Ensembl Gene ENSMUSG00000040724
Gene Name potassium voltage-gated channel, shaker-related subfamily, member 2
Synonyms Akr6a4, Kca1-2, Kv1.2, Mk-2
MMRRC Submission 042659-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5069 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 107008462-107022321 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107011953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 178 (V178D)
Ref Sequence ENSEMBL: ENSMUSP00000143798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038695] [ENSMUST00000196403] [ENSMUST00000197470]
AlphaFold P63141
Predicted Effect probably damaging
Transcript: ENSMUST00000038695
AA Change: V178D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041702
Gene: ENSMUSG00000040724
AA Change: V178D

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196403
AA Change: V178D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142873
Gene: ENSMUSG00000040724
AA Change: V178D

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
low complexity region 164 179 N/A INTRINSIC
Pfam:Ion_trans 224 409 1.3e-36 PFAM
Pfam:Ion_trans_2 329 414 7.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197470
AA Change: V178D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143798
Gene: ENSMUSG00000040724
AA Change: V178D

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
AAdacl4fm3 T A 4: 144,430,437 (GRCm39) D184V probably damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Adcy7 T C 8: 89,054,325 (GRCm39) L1060P probably damaging Het
Aff3 A G 1: 38,220,694 (GRCm39) probably null Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd27 A T 7: 35,327,860 (GRCm39) K793N probably damaging Het
Arhgef28 T C 13: 98,211,714 (GRCm39) T90A probably damaging Het
Armc9 A T 1: 86,184,959 (GRCm39) H670L probably benign Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Ass1 C T 2: 31,400,185 (GRCm39) T301M probably damaging Het
Baiap3 A T 17: 25,468,082 (GRCm39) C283S probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cdh3 A G 8: 107,263,458 (GRCm39) N126S probably benign Het
Cfap54 A C 10: 92,773,636 (GRCm39) F135L probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Elapor2 T A 5: 9,490,897 (GRCm39) C636S probably damaging Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Firrm T C 1: 163,815,243 (GRCm39) T93A possibly damaging Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gm1043 T G 5: 37,344,580 (GRCm39) L231R probably damaging Het
Gpr153 T A 4: 152,364,340 (GRCm39) M132K probably damaging Het
Hbs1l T A 10: 21,230,546 (GRCm39) S496T probably damaging Het
Inpp5f A G 7: 128,278,451 (GRCm39) probably null Het
Kat6a G A 8: 23,393,149 (GRCm39) C209Y probably damaging Het
Krt75 A G 15: 101,474,673 (GRCm39) probably null Het
Letm2 G A 8: 26,083,980 (GRCm39) Q84* probably null Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Muc6 A G 7: 141,237,564 (GRCm39) C218R probably damaging Het
Myof A T 19: 37,893,773 (GRCm39) I1130N possibly damaging Het
Neil3 A G 8: 54,054,076 (GRCm39) S318P possibly damaging Het
Nhlh1 A G 1: 171,881,467 (GRCm39) V133A probably benign Het
Nup153 A C 13: 46,863,268 (GRCm39) S331A probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or9s23 T A 1: 92,501,135 (GRCm39) S81T probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pald1 A T 10: 61,177,025 (GRCm39) M675K possibly damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pitpnm1 C T 19: 4,161,140 (GRCm39) A897V probably benign Het
Plxnd1 A T 6: 115,942,862 (GRCm39) V1274E probably damaging Het
Polr2a T C 11: 69,627,561 (GRCm39) probably null Het
Ppfia1 G A 7: 144,068,210 (GRCm39) Q446* probably null Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rhbdl2 T A 4: 123,711,710 (GRCm39) L149* probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rtel1 G A 2: 180,997,285 (GRCm39) V1042M probably benign Het
Sidt2 A T 9: 45,850,759 (GRCm39) probably null Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc28a2b A T 2: 122,324,854 (GRCm39) N142I possibly damaging Het
Slc4a10 G A 2: 62,097,915 (GRCm39) R508H probably benign Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slf2 T A 19: 44,923,692 (GRCm39) S169T possibly damaging Het
Snx33 A T 9: 56,833,475 (GRCm39) I198N probably damaging Het
Spock3 A G 8: 63,808,299 (GRCm39) T396A probably benign Het
Sva A T 6: 42,015,351 (GRCm39) probably benign Het
Syt7 A G 19: 10,416,601 (GRCm39) N261S probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Thoc2 C T X: 40,895,570 (GRCm39) E1491K probably damaging Het
Tlr1 T C 5: 65,083,743 (GRCm39) Y278C probably benign Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Trpm4 T G 7: 44,959,893 (GRCm39) Y667S probably damaging Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Ube4a T C 9: 44,851,387 (GRCm39) H709R probably damaging Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wars2 A G 3: 99,094,849 (GRCm39) H48R probably damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Other mutations in Kcna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcna2 APN 3 107,011,946 (GRCm39) missense probably damaging 1.00
IGL00711:Kcna2 APN 3 107,012,069 (GRCm39) missense probably benign
IGL02380:Kcna2 APN 3 107,012,274 (GRCm39) missense probably benign 0.00
grim UTSW 3 107,012,343 (GRCm39) missense probably damaging 1.00
IGL03097:Kcna2 UTSW 3 107,012,715 (GRCm39) missense probably benign 0.02
R0117:Kcna2 UTSW 3 107,012,670 (GRCm39) missense probably damaging 1.00
R0200:Kcna2 UTSW 3 107,012,476 (GRCm39) missense probably benign
R0463:Kcna2 UTSW 3 107,012,476 (GRCm39) missense probably benign
R0472:Kcna2 UTSW 3 107,012,832 (GRCm39) missense probably benign
R0662:Kcna2 UTSW 3 107,012,717 (GRCm39) missense probably benign
R0746:Kcna2 UTSW 3 107,012,484 (GRCm39) missense probably benign
R1838:Kcna2 UTSW 3 107,011,828 (GRCm39) missense probably benign
R1847:Kcna2 UTSW 3 107,012,429 (GRCm39) missense possibly damaging 0.54
R1912:Kcna2 UTSW 3 107,012,717 (GRCm39) missense probably benign
R1966:Kcna2 UTSW 3 107,011,946 (GRCm39) missense probably damaging 1.00
R1971:Kcna2 UTSW 3 107,012,140 (GRCm39) missense probably damaging 1.00
R2419:Kcna2 UTSW 3 107,011,469 (GRCm39) missense probably benign 0.21
R3796:Kcna2 UTSW 3 107,012,906 (GRCm39) missense probably benign 0.37
R3830:Kcna2 UTSW 3 107,012,112 (GRCm39) missense probably benign 0.04
R4273:Kcna2 UTSW 3 107,012,509 (GRCm39) missense probably benign 0.00
R4570:Kcna2 UTSW 3 107,012,111 (GRCm39) missense probably benign
R4662:Kcna2 UTSW 3 107,012,733 (GRCm39) missense probably benign
R4756:Kcna2 UTSW 3 107,012,733 (GRCm39) missense probably benign
R5054:Kcna2 UTSW 3 107,011,656 (GRCm39) missense probably damaging 1.00
R5070:Kcna2 UTSW 3 107,011,953 (GRCm39) missense probably damaging 1.00
R5126:Kcna2 UTSW 3 107,011,550 (GRCm39) missense probably damaging 1.00
R5146:Kcna2 UTSW 3 107,012,814 (GRCm39) missense probably benign 0.00
R5205:Kcna2 UTSW 3 107,004,462 (GRCm39) unclassified probably benign
R5472:Kcna2 UTSW 3 107,012,625 (GRCm39) missense possibly damaging 0.93
R6687:Kcna2 UTSW 3 107,012,343 (GRCm39) missense probably damaging 1.00
R6689:Kcna2 UTSW 3 107,012,343 (GRCm39) missense probably damaging 1.00
R7216:Kcna2 UTSW 3 107,012,109 (GRCm39) missense probably damaging 0.99
R7304:Kcna2 UTSW 3 107,012,066 (GRCm39) missense probably benign
R7538:Kcna2 UTSW 3 107,011,884 (GRCm39) missense probably benign 0.31
R7585:Kcna2 UTSW 3 107,012,658 (GRCm39) missense probably damaging 1.00
R7968:Kcna2 UTSW 3 107,012,460 (GRCm39) missense possibly damaging 0.79
R8241:Kcna2 UTSW 3 107,012,338 (GRCm39) missense probably damaging 1.00
R9223:Kcna2 UTSW 3 107,012,306 (GRCm39) missense possibly damaging 0.93
R9441:Kcna2 UTSW 3 107,012,268 (GRCm39) missense probably benign
R9449:Kcna2 UTSW 3 107,012,887 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAATGGAGATGTTTCGGG -3'
(R):5'- GTTCATGATGTTGGTGAAGAAGCC -3'

Sequencing Primer
(F):5'- TTTCGGGAGGATGAAGGCTACATC -3'
(R):5'- TGGTGAAGAAGCCAGCTTTGC -3'
Posted On 2016-06-06