Incidental Mutation 'R5069:9330182L06Rik'
ID388531
Institutional Source Beutler Lab
Gene Symbol 9330182L06Rik
Ensembl Gene ENSMUSG00000056004
Gene NameRIKEN cDNA 9330182L06 gene
Synonyms
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location9266118-9481825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9440897 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 636 (C636S)
Ref Sequence ENSEMBL: ENSMUSP00000121757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069538] [ENSMUST00000115348] [ENSMUST00000134991] [ENSMUST00000152095] [ENSMUST00000154662] [ENSMUST00000155764]
Predicted Effect probably damaging
Transcript: ENSMUST00000069538
AA Change: C636S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069165
Gene: ENSMUSG00000056004
AA Change: C636S

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 1.12e-7 PROSPERO
internal_repeat_1 343 665 1.12e-7 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115348
SMART Domains Protein: ENSMUSP00000111005
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134991
AA Change: C636S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121757
Gene: ENSMUSG00000056004
AA Change: C636S

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 9.82e-8 PROSPERO
internal_repeat_1 343 665 9.82e-8 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152095
SMART Domains Protein: ENSMUSP00000116440
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154662
SMART Domains Protein: ENSMUSP00000116026
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155764
SMART Domains Protein: ENSMUSP00000120849
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 180 5.47e-6 PROSPERO
internal_repeat_1 343 476 5.47e-6 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in 9330182L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:9330182L06Rik APN 5 9422367 missense probably damaging 0.99
IGL00909:9330182L06Rik APN 5 9380282 missense probably damaging 1.00
IGL01477:9330182L06Rik APN 5 9437756 missense probably damaging 1.00
IGL02486:9330182L06Rik APN 5 9422323 missense probably benign 0.00
IGL02863:9330182L06Rik APN 5 9461399 nonsense probably null
IGL02939:9330182L06Rik APN 5 9461478 missense probably damaging 1.00
IGL03039:9330182L06Rik APN 5 9418055 missense probably benign 0.12
IGL03395:9330182L06Rik APN 5 9422359 missense probably damaging 0.97
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0193:9330182L06Rik UTSW 5 9422359 missense probably damaging 0.97
R0265:9330182L06Rik UTSW 5 9434681 missense probably damaging 1.00
R0398:9330182L06Rik UTSW 5 9445367 missense probably benign 0.00
R0432:9330182L06Rik UTSW 5 9440966 nonsense probably null
R0494:9330182L06Rik UTSW 5 9420723 critical splice donor site probably null
R0736:9330182L06Rik UTSW 5 9441745 missense probably damaging 1.00
R0850:9330182L06Rik UTSW 5 9417993 missense probably damaging 1.00
R1398:9330182L06Rik UTSW 5 9380297 missense probably damaging 1.00
R1709:9330182L06Rik UTSW 5 9440726 nonsense probably null
R1720:9330182L06Rik UTSW 5 9428407 missense probably damaging 1.00
R1770:9330182L06Rik UTSW 5 9418021 missense probably benign 0.01
R1782:9330182L06Rik UTSW 5 9421620 missense possibly damaging 0.62
R1803:9330182L06Rik UTSW 5 9427832 missense probably benign 0.05
R1868:9330182L06Rik UTSW 5 9479251 missense probably damaging 1.00
R1870:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1871:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1913:9330182L06Rik UTSW 5 9266275 missense probably damaging 0.97
R2054:9330182L06Rik UTSW 5 9463030 missense possibly damaging 0.81
R2170:9330182L06Rik UTSW 5 9479206 missense probably damaging 1.00
R2381:9330182L06Rik UTSW 5 9380342 missense probably damaging 1.00
R2396:9330182L06Rik UTSW 5 9435395 missense possibly damaging 0.92
R4003:9330182L06Rik UTSW 5 9440877 missense probably benign 0.05
R5030:9330182L06Rik UTSW 5 9428502 missense probably damaging 1.00
R5049:9330182L06Rik UTSW 5 9428488 missense probably damaging 1.00
R5219:9330182L06Rik UTSW 5 9461486 missense probably damaging 1.00
R5400:9330182L06Rik UTSW 5 9479247 missense probably damaging 1.00
R5555:9330182L06Rik UTSW 5 9422296 splice site probably null
R5593:9330182L06Rik UTSW 5 9266350 missense probably benign 0.07
R5681:9330182L06Rik UTSW 5 9459308 critical splice donor site probably null
R5707:9330182L06Rik UTSW 5 9441698 missense probably damaging 1.00
R5756:9330182L06Rik UTSW 5 9462995 missense probably damaging 0.98
R6087:9330182L06Rik UTSW 5 9399255 missense probably damaging 1.00
R6252:9330182L06Rik UTSW 5 9410693 missense probably damaging 1.00
R7067:9330182L06Rik UTSW 5 9266295 missense possibly damaging 0.81
R7078:9330182L06Rik UTSW 5 9410709 missense probably benign 0.10
R7079:9330182L06Rik UTSW 5 9399253 missense probably damaging 1.00
R7117:9330182L06Rik UTSW 5 9445384 nonsense probably null
R7265:9330182L06Rik UTSW 5 9446975 missense possibly damaging 0.65
R7996:9330182L06Rik UTSW 5 9462881 missense probably damaging 1.00
R8199:9330182L06Rik UTSW 5 9420657 missense probably damaging 1.00
R8246:9330182L06Rik UTSW 5 9446966 missense probably benign 0.07
R8935:9330182L06Rik UTSW 5 9441764 missense probably damaging 1.00
R8963:9330182L06Rik UTSW 5 9437792 missense probably damaging 1.00
X0019:9330182L06Rik UTSW 5 9399231 missense probably damaging 0.97
X0052:9330182L06Rik UTSW 5 9440908 missense possibly damaging 0.87
X0063:9330182L06Rik UTSW 5 9399239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCACTCCAAGGCAGATG -3'
(R):5'- TGAGAATTGCAGAGCATTTTCC -3'

Sequencing Primer
(F):5'- TGCTCTCTTTCTAGAACAGACG -3'
(R):5'- GCAGAGCATTTTCCAGCATCGATAG -3'
Posted On2016-06-06