Incidental Mutation 'R5069:Trpm4'
ID388539
Institutional Source Beutler Lab
Gene Symbol Trpm4
Ensembl Gene ENSMUSG00000038260
Gene Nametransient receptor potential cation channel, subfamily M, member 4
SynonymsLTRPC4, TRPM4B, 1110030C19Rik
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45302632-45333780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45310469 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 667 (Y667S)
Ref Sequence ENSEMBL: ENSMUSP00000147793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably damaging
Transcript: ENSMUST00000042194
AA Change: Y814S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260
AA Change: Y814S

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209239
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably damaging
Transcript: ENSMUST00000211743
AA Change: Y667S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Trpm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trpm4 APN 7 45318349 missense probably benign
IGL01327:Trpm4 APN 7 45315073 missense probably damaging 1.00
IGL02069:Trpm4 APN 7 45319294 missense probably damaging 1.00
IGL02124:Trpm4 APN 7 45310523 missense probably damaging 1.00
IGL02141:Trpm4 APN 7 45318179 splice site probably null
IGL02333:Trpm4 APN 7 45322115 missense possibly damaging 0.85
IGL02338:Trpm4 APN 7 45326998 missense probably damaging 1.00
IGL02741:Trpm4 APN 7 45318488 missense possibly damaging 0.82
R0041:Trpm4 UTSW 7 45304946 critical splice donor site probably null
R0106:Trpm4 UTSW 7 45319240 critical splice donor site probably null
R0270:Trpm4 UTSW 7 45319253 missense possibly damaging 0.45
R0279:Trpm4 UTSW 7 45322048 missense probably damaging 0.99
R0309:Trpm4 UTSW 7 45308706 missense probably damaging 1.00
R0539:Trpm4 UTSW 7 45305472 missense probably damaging 0.99
R0969:Trpm4 UTSW 7 45327907 intron probably benign
R1454:Trpm4 UTSW 7 45317056 missense probably damaging 0.99
R1512:Trpm4 UTSW 7 45315044 missense probably benign 0.07
R1579:Trpm4 UTSW 7 45308597 missense probably damaging 1.00
R1768:Trpm4 UTSW 7 45308612 missense probably damaging 0.97
R2847:Trpm4 UTSW 7 45310598 missense probably damaging 1.00
R3883:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R3884:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R4895:Trpm4 UTSW 7 45318058 missense probably damaging 0.98
R5056:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
R5060:Trpm4 UTSW 7 45321834 missense probably damaging 1.00
R5560:Trpm4 UTSW 7 45310332 missense probably damaging 1.00
R5783:Trpm4 UTSW 7 45310389 missense probably benign
R5874:Trpm4 UTSW 7 45327749 missense probably damaging 1.00
R6176:Trpm4 UTSW 7 45326676 missense probably damaging 1.00
R6302:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R6431:Trpm4 UTSW 7 45326568 missense possibly damaging 0.79
R6762:Trpm4 UTSW 7 45304816 utr 3 prime probably benign
R6827:Trpm4 UTSW 7 45318628 missense possibly damaging 0.89
R6845:Trpm4 UTSW 7 45322329 missense possibly damaging 0.88
R6950:Trpm4 UTSW 7 45319280 missense probably damaging 0.97
R7126:Trpm4 UTSW 7 45310709 splice site probably null
R7159:Trpm4 UTSW 7 45327268 splice site probably null
R7167:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R7386:Trpm4 UTSW 7 45314640 missense possibly damaging 0.47
R7516:Trpm4 UTSW 7 45305020 missense probably damaging 1.00
R7655:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7656:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7743:Trpm4 UTSW 7 45308338 missense probably benign 0.14
R8060:Trpm4 UTSW 7 45305451 missense probably damaging 1.00
X0018:Trpm4 UTSW 7 45314634 missense possibly damaging 0.61
X0022:Trpm4 UTSW 7 45310511 missense probably damaging 1.00
Z1177:Trpm4 UTSW 7 45326718 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTTACTCACTCACCGGCAG -3'
(R):5'- CTGTAGAACCCTCTGCAAAGG -3'

Sequencing Primer
(F):5'- TACGCCCAGCAGGAAGC -3'
(R):5'- ACCCTCTGCAAAGGTGGCC -3'
Posted On2016-06-06