Mutagenetix > Incidental Mutation

Incidental Mutation 'R5069:Trpm4'

388539

Institutional Source

Beutler Lab

Gene Symbol

Trpm4

Ensembl Gene

ENSMUSG00000038260

Gene Name

transient receptor potential cation channel, subfamily M, member 4

Synonyms

LTRPC4, TRPM4B, 1110030C19Rik

MMRRC Submission

042659-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45302632-45333780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 45310469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 667 (Y667S)

Ref Sequence

ENSEMBL: ENSMUSP00000147793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000211431] [ENSMUST00000211743]

AlphaFold

Q7TN37

Predicted Effect

probably damaging
Transcript: ENSMUST00000042194
AA Change: Y814S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260
AA Change: Y814S

Domain	Start	End	E-Value	Type
low complexity region	118	131	N/A	INTRINSIC
SCOP:d1awcb_	378	465	2e-3	SMART
low complexity region	600	612	N/A	INTRINSIC
low complexity region	637	645	N/A	INTRINSIC
transmembrane domain	688	710	N/A	INTRINSIC
Pfam:Ion_trans	781	1051	1.8e-13	PFAM
low complexity region	1089	1096	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209239

Predicted Effect

probably benign
Transcript: ENSMUST00000211431

Predicted Effect

probably damaging
Transcript: ENSMUST00000211743
AA Change: Y667S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Trpm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Trpm4	APN	7	45318349	missense	probably benign
IGL01327:Trpm4	APN	7	45315073	missense	probably damaging	1.00
IGL02069:Trpm4	APN	7	45319294	missense	probably damaging	1.00
IGL02124:Trpm4	APN	7	45310523	missense	probably damaging	1.00
IGL02141:Trpm4	APN	7	45318179	splice site	probably null
IGL02333:Trpm4	APN	7	45322115	missense	possibly damaging	0.85
IGL02338:Trpm4	APN	7	45326998	missense	probably damaging	1.00
IGL02741:Trpm4	APN	7	45318488	missense	possibly damaging	0.82
R0041:Trpm4	UTSW	7	45304946	critical splice donor site	probably null
R0106:Trpm4	UTSW	7	45319240	critical splice donor site	probably null
R0270:Trpm4	UTSW	7	45319253	missense	possibly damaging	0.45
R0279:Trpm4	UTSW	7	45322048	missense	probably damaging	0.99
R0309:Trpm4	UTSW	7	45308706	missense	probably damaging	1.00
R0539:Trpm4	UTSW	7	45305472	missense	probably damaging	0.99
R0969:Trpm4	UTSW	7	45327907	intron	probably benign
R1454:Trpm4	UTSW	7	45317056	missense	probably damaging	0.99
R1512:Trpm4	UTSW	7	45315044	missense	probably benign	0.07
R1579:Trpm4	UTSW	7	45308597	missense	probably damaging	1.00
R1768:Trpm4	UTSW	7	45308612	missense	probably damaging	0.97
R2847:Trpm4	UTSW	7	45310598	missense	probably damaging	1.00
R3883:Trpm4	UTSW	7	45321998	critical splice donor site	probably null
R3884:Trpm4	UTSW	7	45321998	critical splice donor site	probably null
R4895:Trpm4	UTSW	7	45318058	missense	probably damaging	0.98
R5056:Trpm4	UTSW	7	45308630	missense	probably damaging	0.98
R5060:Trpm4	UTSW	7	45321834	missense	probably damaging	1.00
R5560:Trpm4	UTSW	7	45310332	missense	probably damaging	1.00
R5783:Trpm4	UTSW	7	45310389	missense	probably benign
R5874:Trpm4	UTSW	7	45327749	missense	probably damaging	1.00
R6176:Trpm4	UTSW	7	45326676	missense	probably damaging	1.00
R6302:Trpm4	UTSW	7	45327719	critical splice donor site	probably null
R6431:Trpm4	UTSW	7	45326568	missense	possibly damaging	0.79
R6762:Trpm4	UTSW	7	45304816	utr 3 prime	probably benign
R6827:Trpm4	UTSW	7	45318628	missense	possibly damaging	0.89
R6845:Trpm4	UTSW	7	45322329	missense	possibly damaging	0.88
R6950:Trpm4	UTSW	7	45319280	missense	probably damaging	0.97
R7126:Trpm4	UTSW	7	45310709	splice site	probably null
R7159:Trpm4	UTSW	7	45327268	splice site	probably null
R7167:Trpm4	UTSW	7	45327719	critical splice donor site	probably null
R7386:Trpm4	UTSW	7	45314640	missense	possibly damaging	0.47
R7516:Trpm4	UTSW	7	45305020	missense	probably damaging	1.00
R7655:Trpm4	UTSW	7	45321809	missense	probably benign	0.00
R7656:Trpm4	UTSW	7	45321809	missense	probably benign	0.00
R7743:Trpm4	UTSW	7	45308338	missense	probably benign	0.14
R7943:Trpm4	UTSW	7	45308681	missense	probably damaging	1.00
R7955:Trpm4	UTSW	7	45319259	missense	probably damaging	1.00
R8060:Trpm4	UTSW	7	45305451	missense	probably damaging	1.00
R8119:Trpm4	UTSW	7	45327128	missense	probably damaging	1.00
R8225:Trpm4	UTSW	7	45305334	missense	probably benign
R8395:Trpm4	UTSW	7	45309210	missense	probably benign	0.00
R8509:Trpm4	UTSW	7	45322361	missense	probably damaging	1.00
R8897:Trpm4	UTSW	7	45310631	missense	probably benign	0.02
R9577:Trpm4	UTSW	7	45305008	nonsense	probably null
R9674:Trpm4	UTSW	7	45333387	missense	possibly damaging	0.87
R9731:Trpm4	UTSW	7	45308630	missense	probably damaging	0.98
X0018:Trpm4	UTSW	7	45314634	missense	possibly damaging	0.61
X0022:Trpm4	UTSW	7	45310511	missense	probably damaging	1.00
Z1177:Trpm4	UTSW	7	45326718	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCTTACTCACTCACCGGCAG -3'
(R):5'- CTGTAGAACCCTCTGCAAAGG -3'

Sequencing Primer
(F):5'- TACGCCCAGCAGGAAGC -3'
(R):5'- ACCCTCTGCAAAGGTGGCC -3'

Posted On

2016-06-06