Incidental Mutation 'R5069:Nup98'
ID 388540
Institutional Source Beutler Lab
Gene Symbol Nup98
Ensembl Gene ENSMUSG00000063550
Gene Name nucleoporin 98
Synonyms Nup96
MMRRC Submission 042659-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5069 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 101768607-101859359 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101794862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 882 (T882A)
Ref Sequence ENSEMBL: ENSMUSP00000147454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070165
AA Change: T899A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: T899A

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG 3 88 4.6e-4 PFAM
Pfam:Nucleoporin_FG 69 170 3.4e-6 PFAM
Pfam:Nucleoporin_FG 210 307 6.1e-5 PFAM
Pfam:Nucleoporin_FG 246 332 2.2e-7 PFAM
Pfam:Nucleoporin_FG 266 359 1.2e-7 PFAM
Pfam:Nucleoporin_FG 309 425 1.8e-2 PFAM
Pfam:Nucleoporin_FG 398 497 2.2e-2 PFAM
low complexity region 594 610 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
Pfam:Nucleoporin2 740 880 5.4e-45 PFAM
PDB:1KO6|D 881 925 1e-16 PDB
low complexity region 926 935 N/A INTRINSIC
low complexity region 1033 1042 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210682
AA Change: T899A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211005
AA Change: T899A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211022
AA Change: T882A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211235
AA Change: T882A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
AAdacl4fm3 T A 4: 144,430,437 (GRCm39) D184V probably damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Adcy7 T C 8: 89,054,325 (GRCm39) L1060P probably damaging Het
Aff3 A G 1: 38,220,694 (GRCm39) probably null Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd27 A T 7: 35,327,860 (GRCm39) K793N probably damaging Het
Arhgef28 T C 13: 98,211,714 (GRCm39) T90A probably damaging Het
Armc9 A T 1: 86,184,959 (GRCm39) H670L probably benign Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Ass1 C T 2: 31,400,185 (GRCm39) T301M probably damaging Het
Baiap3 A T 17: 25,468,082 (GRCm39) C283S probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cdh3 A G 8: 107,263,458 (GRCm39) N126S probably benign Het
Cfap54 A C 10: 92,773,636 (GRCm39) F135L probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Elapor2 T A 5: 9,490,897 (GRCm39) C636S probably damaging Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Firrm T C 1: 163,815,243 (GRCm39) T93A possibly damaging Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gm1043 T G 5: 37,344,580 (GRCm39) L231R probably damaging Het
Gpr153 T A 4: 152,364,340 (GRCm39) M132K probably damaging Het
Hbs1l T A 10: 21,230,546 (GRCm39) S496T probably damaging Het
Inpp5f A G 7: 128,278,451 (GRCm39) probably null Het
Kat6a G A 8: 23,393,149 (GRCm39) C209Y probably damaging Het
Kcna2 T A 3: 107,011,953 (GRCm39) V178D probably damaging Het
Krt75 A G 15: 101,474,673 (GRCm39) probably null Het
Letm2 G A 8: 26,083,980 (GRCm39) Q84* probably null Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Muc6 A G 7: 141,237,564 (GRCm39) C218R probably damaging Het
Myof A T 19: 37,893,773 (GRCm39) I1130N possibly damaging Het
Neil3 A G 8: 54,054,076 (GRCm39) S318P possibly damaging Het
Nhlh1 A G 1: 171,881,467 (GRCm39) V133A probably benign Het
Nup153 A C 13: 46,863,268 (GRCm39) S331A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or9s23 T A 1: 92,501,135 (GRCm39) S81T probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pald1 A T 10: 61,177,025 (GRCm39) M675K possibly damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pitpnm1 C T 19: 4,161,140 (GRCm39) A897V probably benign Het
Plxnd1 A T 6: 115,942,862 (GRCm39) V1274E probably damaging Het
Polr2a T C 11: 69,627,561 (GRCm39) probably null Het
Ppfia1 G A 7: 144,068,210 (GRCm39) Q446* probably null Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rhbdl2 T A 4: 123,711,710 (GRCm39) L149* probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rtel1 G A 2: 180,997,285 (GRCm39) V1042M probably benign Het
Sidt2 A T 9: 45,850,759 (GRCm39) probably null Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc28a2b A T 2: 122,324,854 (GRCm39) N142I possibly damaging Het
Slc4a10 G A 2: 62,097,915 (GRCm39) R508H probably benign Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slf2 T A 19: 44,923,692 (GRCm39) S169T possibly damaging Het
Snx33 A T 9: 56,833,475 (GRCm39) I198N probably damaging Het
Spock3 A G 8: 63,808,299 (GRCm39) T396A probably benign Het
Sva A T 6: 42,015,351 (GRCm39) probably benign Het
Syt7 A G 19: 10,416,601 (GRCm39) N261S probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Thoc2 C T X: 40,895,570 (GRCm39) E1491K probably damaging Het
Tlr1 T C 5: 65,083,743 (GRCm39) Y278C probably benign Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Trpm4 T G 7: 44,959,893 (GRCm39) Y667S probably damaging Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Ube4a T C 9: 44,851,387 (GRCm39) H709R probably damaging Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wars2 A G 3: 99,094,849 (GRCm39) H48R probably damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Other mutations in Nup98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Nup98 APN 7 101,844,194 (GRCm39) missense probably damaging 1.00
IGL00789:Nup98 APN 7 101,803,178 (GRCm39) missense probably benign
IGL00798:Nup98 APN 7 101,796,411 (GRCm39) missense probably damaging 1.00
IGL01562:Nup98 APN 7 101,835,125 (GRCm39) missense probably damaging 0.99
IGL01942:Nup98 APN 7 101,843,918 (GRCm39) missense probably damaging 1.00
IGL02109:Nup98 APN 7 101,832,693 (GRCm39) missense probably benign 0.37
IGL02490:Nup98 APN 7 101,801,573 (GRCm39) missense probably damaging 1.00
IGL03184:Nup98 APN 7 101,832,752 (GRCm39) missense probably damaging 0.99
PIT4519001:Nup98 UTSW 7 101,784,171 (GRCm39) missense probably benign 0.00
R0040:Nup98 UTSW 7 101,841,241 (GRCm39) missense probably damaging 1.00
R0133:Nup98 UTSW 7 101,788,859 (GRCm39) critical splice acceptor site probably null
R0309:Nup98 UTSW 7 101,801,635 (GRCm39) missense probably null
R0471:Nup98 UTSW 7 101,788,004 (GRCm39) missense probably benign 0.13
R0538:Nup98 UTSW 7 101,835,892 (GRCm39) missense probably damaging 1.00
R0650:Nup98 UTSW 7 101,801,660 (GRCm39) missense probably damaging 1.00
R0730:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R0881:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R0900:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R1120:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R1159:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R1469:Nup98 UTSW 7 101,788,008 (GRCm39) missense probably benign 0.00
R1469:Nup98 UTSW 7 101,788,008 (GRCm39) missense probably benign 0.00
R1470:Nup98 UTSW 7 101,796,513 (GRCm39) missense probably damaging 0.98
R1470:Nup98 UTSW 7 101,796,513 (GRCm39) missense probably damaging 0.98
R1545:Nup98 UTSW 7 101,784,087 (GRCm39) missense possibly damaging 0.77
R1775:Nup98 UTSW 7 101,784,144 (GRCm39) missense probably benign 0.03
R1889:Nup98 UTSW 7 101,809,923 (GRCm39) missense probably damaging 1.00
R2080:Nup98 UTSW 7 101,829,631 (GRCm39) missense probably damaging 0.96
R3423:Nup98 UTSW 7 101,834,084 (GRCm39) missense probably benign 0.03
R4361:Nup98 UTSW 7 101,794,921 (GRCm39) missense probably damaging 1.00
R4678:Nup98 UTSW 7 101,834,038 (GRCm39) missense probably damaging 1.00
R4864:Nup98 UTSW 7 101,802,403 (GRCm39) missense possibly damaging 0.94
R4910:Nup98 UTSW 7 101,845,007 (GRCm39) missense unknown
R4924:Nup98 UTSW 7 101,784,185 (GRCm39) missense probably damaging 1.00
R5068:Nup98 UTSW 7 101,794,862 (GRCm39) missense probably benign 0.00
R5233:Nup98 UTSW 7 101,845,029 (GRCm39) missense unknown
R5779:Nup98 UTSW 7 101,801,568 (GRCm39) missense probably benign
R5922:Nup98 UTSW 7 101,803,224 (GRCm39) missense probably damaging 1.00
R6010:Nup98 UTSW 7 101,829,636 (GRCm39) missense probably damaging 1.00
R6039:Nup98 UTSW 7 101,784,002 (GRCm39) missense probably benign
R6039:Nup98 UTSW 7 101,784,002 (GRCm39) missense probably benign
R6343:Nup98 UTSW 7 101,843,957 (GRCm39) missense possibly damaging 0.90
R6364:Nup98 UTSW 7 101,825,522 (GRCm39) missense probably damaging 1.00
R6462:Nup98 UTSW 7 101,844,223 (GRCm39) missense probably benign 0.03
R6577:Nup98 UTSW 7 101,778,053 (GRCm39) splice site probably null
R6900:Nup98 UTSW 7 101,835,169 (GRCm39) missense probably damaging 1.00
R7205:Nup98 UTSW 7 101,844,248 (GRCm39) missense unknown
R7218:Nup98 UTSW 7 101,841,107 (GRCm39) splice site probably null
R7235:Nup98 UTSW 7 101,774,491 (GRCm39) missense probably damaging 1.00
R7307:Nup98 UTSW 7 101,784,002 (GRCm39) missense probably benign
R7402:Nup98 UTSW 7 101,784,144 (GRCm39) missense probably benign 0.00
R7427:Nup98 UTSW 7 101,784,208 (GRCm39) splice site probably null
R7428:Nup98 UTSW 7 101,784,208 (GRCm39) splice site probably null
R7584:Nup98 UTSW 7 101,825,596 (GRCm39) missense probably benign 0.02
R7646:Nup98 UTSW 7 101,803,242 (GRCm39) missense probably benign 0.01
R7648:Nup98 UTSW 7 101,773,404 (GRCm39) missense possibly damaging 0.94
R7742:Nup98 UTSW 7 101,802,464 (GRCm39) splice site probably null
R7827:Nup98 UTSW 7 101,773,569 (GRCm39) missense probably benign 0.10
R7884:Nup98 UTSW 7 101,825,556 (GRCm39) missense probably benign 0.12
R7943:Nup98 UTSW 7 101,844,029 (GRCm39) missense probably benign 0.10
R8034:Nup98 UTSW 7 101,794,930 (GRCm39) critical splice acceptor site probably null
R8952:Nup98 UTSW 7 101,835,859 (GRCm39) missense probably damaging 1.00
R9060:Nup98 UTSW 7 101,783,895 (GRCm39) missense probably damaging 1.00
R9099:Nup98 UTSW 7 101,844,173 (GRCm39) missense probably damaging 0.98
R9146:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9148:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9223:Nup98 UTSW 7 101,834,167 (GRCm39) missense possibly damaging 0.82
R9246:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9249:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9272:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9274:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9283:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9326:Nup98 UTSW 7 101,788,037 (GRCm39) missense probably benign 0.02
R9466:Nup98 UTSW 7 101,818,611 (GRCm39) missense probably benign 0.05
R9492:Nup98 UTSW 7 101,778,252 (GRCm39) missense probably benign 0.11
R9661:Nup98 UTSW 7 101,782,019 (GRCm39) nonsense probably null
T0970:Nup98 UTSW 7 101,835,959 (GRCm39) unclassified probably benign
X0054:Nup98 UTSW 7 101,796,415 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCTGTAGAATGATCCAAACAGC -3'
(R):5'- GCACTGAACATTGTCAAAGTCATAG -3'

Sequencing Primer
(F):5'- CAGCAAGAAAACCCTTTAAATCTTG -3'
(R):5'- ACCAGAACTTTGGACTGCTG -3'
Posted On 2016-06-06