Incidental Mutation 'R5069:Or52ab4'
ID 388541
Institutional Source Beutler Lab
Gene Symbol Or52ab4
Ensembl Gene ENSMUSG00000073950
Gene Name olfactory receptor family 52 subfamily AB member 4
Synonyms Olfr599, MOR23-1, GA_x6K02T2PBJ9-6047402-6048349
MMRRC Submission 042659-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5069 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102987219-102988268 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) A to T at 102987229 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098201] [ENSMUST00000214329]
AlphaFold Q8VG01
Predicted Effect probably null
Transcript: ENSMUST00000098201
SMART Domains Protein: ENSMUSP00000095803
Gene: ENSMUSG00000073950

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.8e-94 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.2e-6 PFAM
Pfam:7tm_1 43 293 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214329
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
AAdacl4fm3 T A 4: 144,430,437 (GRCm39) D184V probably damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Adcy7 T C 8: 89,054,325 (GRCm39) L1060P probably damaging Het
Aff3 A G 1: 38,220,694 (GRCm39) probably null Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd27 A T 7: 35,327,860 (GRCm39) K793N probably damaging Het
Arhgef28 T C 13: 98,211,714 (GRCm39) T90A probably damaging Het
Armc9 A T 1: 86,184,959 (GRCm39) H670L probably benign Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Ass1 C T 2: 31,400,185 (GRCm39) T301M probably damaging Het
Baiap3 A T 17: 25,468,082 (GRCm39) C283S probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cdh3 A G 8: 107,263,458 (GRCm39) N126S probably benign Het
Cfap54 A C 10: 92,773,636 (GRCm39) F135L probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Elapor2 T A 5: 9,490,897 (GRCm39) C636S probably damaging Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Firrm T C 1: 163,815,243 (GRCm39) T93A possibly damaging Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gm1043 T G 5: 37,344,580 (GRCm39) L231R probably damaging Het
Gpr153 T A 4: 152,364,340 (GRCm39) M132K probably damaging Het
Hbs1l T A 10: 21,230,546 (GRCm39) S496T probably damaging Het
Inpp5f A G 7: 128,278,451 (GRCm39) probably null Het
Kat6a G A 8: 23,393,149 (GRCm39) C209Y probably damaging Het
Kcna2 T A 3: 107,011,953 (GRCm39) V178D probably damaging Het
Krt75 A G 15: 101,474,673 (GRCm39) probably null Het
Letm2 G A 8: 26,083,980 (GRCm39) Q84* probably null Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Muc6 A G 7: 141,237,564 (GRCm39) C218R probably damaging Het
Myof A T 19: 37,893,773 (GRCm39) I1130N possibly damaging Het
Neil3 A G 8: 54,054,076 (GRCm39) S318P possibly damaging Het
Nhlh1 A G 1: 171,881,467 (GRCm39) V133A probably benign Het
Nup153 A C 13: 46,863,268 (GRCm39) S331A probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or9s23 T A 1: 92,501,135 (GRCm39) S81T probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pald1 A T 10: 61,177,025 (GRCm39) M675K possibly damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pitpnm1 C T 19: 4,161,140 (GRCm39) A897V probably benign Het
Plxnd1 A T 6: 115,942,862 (GRCm39) V1274E probably damaging Het
Polr2a T C 11: 69,627,561 (GRCm39) probably null Het
Ppfia1 G A 7: 144,068,210 (GRCm39) Q446* probably null Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rhbdl2 T A 4: 123,711,710 (GRCm39) L149* probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rtel1 G A 2: 180,997,285 (GRCm39) V1042M probably benign Het
Sidt2 A T 9: 45,850,759 (GRCm39) probably null Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc28a2b A T 2: 122,324,854 (GRCm39) N142I possibly damaging Het
Slc4a10 G A 2: 62,097,915 (GRCm39) R508H probably benign Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slf2 T A 19: 44,923,692 (GRCm39) S169T possibly damaging Het
Snx33 A T 9: 56,833,475 (GRCm39) I198N probably damaging Het
Spock3 A G 8: 63,808,299 (GRCm39) T396A probably benign Het
Sva A T 6: 42,015,351 (GRCm39) probably benign Het
Syt7 A G 19: 10,416,601 (GRCm39) N261S probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Thoc2 C T X: 40,895,570 (GRCm39) E1491K probably damaging Het
Tlr1 T C 5: 65,083,743 (GRCm39) Y278C probably benign Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Trpm4 T G 7: 44,959,893 (GRCm39) Y667S probably damaging Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Ube4a T C 9: 44,851,387 (GRCm39) H709R probably damaging Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wars2 A G 3: 99,094,849 (GRCm39) H48R probably damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Other mutations in Or52ab4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Or52ab4 APN 7 102,987,974 (GRCm39) nonsense probably null
IGL01744:Or52ab4 APN 7 102,987,435 (GRCm39) missense probably damaging 0.98
IGL02011:Or52ab4 APN 7 102,988,056 (GRCm39) missense probably damaging 0.98
IGL02328:Or52ab4 APN 7 102,987,497 (GRCm39) missense probably damaging 1.00
IGL02630:Or52ab4 APN 7 102,987,636 (GRCm39) missense probably damaging 1.00
IGL03119:Or52ab4 APN 7 102,987,929 (GRCm39) missense probably damaging 1.00
PIT4468001:Or52ab4 UTSW 7 102,987,807 (GRCm39) missense probably damaging 1.00
R0599:Or52ab4 UTSW 7 102,987,393 (GRCm39) missense probably damaging 1.00
R4084:Or52ab4 UTSW 7 102,987,527 (GRCm39) missense probably damaging 0.99
R5068:Or52ab4 UTSW 7 102,987,229 (GRCm39) start gained probably null
R5280:Or52ab4 UTSW 7 102,987,708 (GRCm39) missense probably benign
R5816:Or52ab4 UTSW 7 102,988,202 (GRCm39) missense probably benign 0.00
R6560:Or52ab4 UTSW 7 102,987,945 (GRCm39) missense probably benign 0.02
R7001:Or52ab4 UTSW 7 102,987,428 (GRCm39) missense possibly damaging 0.51
R7890:Or52ab4 UTSW 7 102,987,537 (GRCm39) missense probably benign
R8295:Or52ab4 UTSW 7 102,987,474 (GRCm39) missense probably benign 0.08
R8430:Or52ab4 UTSW 7 102,988,164 (GRCm39) missense probably benign 0.01
R8946:Or52ab4 UTSW 7 102,987,573 (GRCm39) missense probably damaging 1.00
R9045:Or52ab4 UTSW 7 102,987,903 (GRCm39) missense probably damaging 0.99
R9402:Or52ab4 UTSW 7 102,988,196 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCCTGAAACTCACATAATCAG -3'
(R):5'- AAGAGGTTTCCCAGCAAAGC -3'

Sequencing Primer
(F):5'- GCCATGCATTTTCACTTACATAATC -3'
(R):5'- GGTTTCCCAGCAAAGCCACAAG -3'
Posted On 2016-06-06