Mutagenetix > Incidental Mutations

Incidental Mutation 'R5069:Muc6'

388545

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

042659-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141633456-141655319 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141651299 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 218 (C218R)

Ref Sequence

ENSEMBL: ENSMUSP00000140483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062451
AA Change: C218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: C218R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000189314
AA Change: C177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191
AA Change: C177R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000190907
AA Change: C218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: C218R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141645902	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141638890	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141648066	nonsense	probably null
IGL01021:Muc6	APN	7	141637162	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141648454	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141646659	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141638614	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141651307	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141650041	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141649804	nonsense	probably null
IGL01810:Muc6	APN	7	141651062	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141639850	intron	probably benign
IGL02192:Muc6	APN	7	141637804	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141649624	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141640575	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141641496	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141640459	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141636940	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141649578	splice site	probably benign
IGL02851:Muc6	APN	7	141648361	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141640147	intron	probably benign
IGL03070:Muc6	APN	7	141644567	splice site	probably benign
IGL03108:Muc6	APN	7	141637489	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141652059	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141648082	missense	probably damaging	1.00
F5770:Muc6	UTSW	7	141647613	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141641574	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141651990	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141634116	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141639559	intron	probably benign
R0234:Muc6	UTSW	7	141649674	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141649674	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141636955	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141652283	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141640468	missense	probably benign
R0503:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141638584	missense	probably benign	0.06
R0792:Muc6	UTSW	7	141639559	intron	probably benign
R0880:Muc6	UTSW	7	141637357	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141644233	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141645855	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141640197	intron	probably benign
R1293:Muc6	UTSW	7	141651990	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141647909	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141652103	splice site	probably benign
R1548:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R1576:Muc6	UTSW	7	141634524	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141647998	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141650487	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141634458	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141637098	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141640062	nonsense	probably null
R1964:Muc6	UTSW	7	141640063	intron	probably benign
R1975:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141634078	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141649810	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141646960	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141637510	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141637510	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141637924	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141637531	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141640384	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141637038	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141648681	splice site	probably benign
R3872:Muc6	UTSW	7	141640600	missense	probably benign
R4029:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141648655	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141637663	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141640089	intron	probably benign
R4509:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141644222	missense	probably benign	0.03
R4594:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R4677:Muc6	UTSW	7	141639790	intron	probably benign
R4678:Muc6	UTSW	7	141644287	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141640159	intron	probably benign
R4737:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R4981:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141639559	intron	probably benign
R5012:Muc6	UTSW	7	141636657	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141640528	missense	probably benign
R5027:Muc6	UTSW	7	141636436	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141644224	missense	probably benign	0.01
R5126:Muc6	UTSW	7	141651299	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141639559	intron	probably benign
R5179:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141651110	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141637923	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141648813	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141636535	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141649585	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141640423	splice site	probably benign
R5808:Muc6	UTSW	7	141640093	intron	probably benign
R5865:Muc6	UTSW	7	141650504	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141641570	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141641574	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141648374	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141640525	missense	probably benign
R6236:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141648821	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141651115	missense	probably benign	0.09
R6418:Muc6	UTSW	7	141639610	intron	probably benign
R6609:Muc6	UTSW	7	141640433	splice site	probably benign
R6610:Muc6	UTSW	7	141640433	splice site	probably benign
R6611:Muc6	UTSW	7	141640433	splice site	probably benign
R6623:Muc6	UTSW	7	141639559	intron	probably benign
R6626:Muc6	UTSW	7	141639559	intron	probably benign
R6817:Muc6	UTSW	7	141651061	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141637540	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141639979	intron	probably benign
R7001:Muc6	UTSW	7	141637407	missense	probably damaging	0.99
R7046:Muc6	UTSW	7	141640189	intron	probably benign
R7097:Muc6	UTSW	7	141634450	frame shift	probably null
R7099:Muc6	UTSW	7	141634450	frame shift	probably null
R7101:Muc6	UTSW	7	141634450	frame shift	probably null
R7107:Muc6	UTSW	7	141634450	frame shift	probably null
R7108:Muc6	UTSW	7	141634450	frame shift	probably null
R7112:Muc6	UTSW	7	141649277	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141634450	frame shift	probably null
R7204:Muc6	UTSW	7	141634450	frame shift	probably null
R7205:Muc6	UTSW	7	141634450	frame shift	probably null
R7222:Muc6	UTSW	7	141634515	missense	unknown
R7230:Muc6	UTSW	7	141649214	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141640575	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141639823	missense	unknown
R7501:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141636541	missense	unknown
R7641:Muc6	UTSW	7	141639825	missense	unknown
R7644:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141648658	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141637060	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141639825	missense	unknown
R7679:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141651057	splice site	probably null
R7806:Muc6	UTSW	7	141637474	missense	possibly damaging	0.53
R7809:Muc6	UTSW	7	141640371	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141645921	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141645420	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141645481	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141640462	missense	unknown
R8130:Muc6	UTSW	7	141647087	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141649408	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141640528	missense	unknown
R8294:Muc6	UTSW	7	141637350	missense	possibly damaging	0.96
R8329:Muc6	UTSW	7	141640258	missense	unknown
R8379:Muc6	UTSW	7	141644312	nonsense	probably null
R8537:Muc6	UTSW	7	141647917	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141642172	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141643282	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141647524	missense	possibly damaging	0.93
V7581:Muc6	UTSW	7	141647613	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141647613	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141651699	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141637914	missense	possibly damaging	0.72
Z1177:Muc6	UTSW	7	141650436	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141651391	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TCTAGCTTCTGGAGTGTAGCATAC -3'
(R):5'- GATAGCAGCTCAGTTTCCCC -3'

Sequencing Primer
(F):5'- AGTGTAGCATACTTATGGGCTTCC -3'
(R):5'- GGAGCTCCTTATGCATTC -3'

Posted On

2016-06-06