Incidental Mutation 'R5069:Ppfia1'
ID388546
Institutional Source Beutler Lab
Gene Symbol Ppfia1
Ensembl Gene ENSMUSG00000037519
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
SynonymsLiprin-alpha1, liprin, C030014K08Rik
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location144476758-144553729 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 144514473 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 446 (Q446*)
Ref Sequence ENSEMBL: ENSMUSP00000138312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168134] [ENSMUST00000182226] [ENSMUST00000182731]
Predicted Effect probably null
Transcript: ENSMUST00000168134
AA Change: Q421*
SMART Domains Protein: ENSMUSP00000126233
Gene: ENSMUSG00000037519
AA Change: Q421*

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 517 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
coiled coil region 621 667 N/A INTRINSIC
low complexity region 681 703 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 791 799 N/A INTRINSIC
SAM 884 953 5.22e-7 SMART
low complexity region 954 966 N/A INTRINSIC
SAM 999 1066 3.89e-6 SMART
SAM 1087 1159 1.14e-7 SMART
low complexity region 1207 1218 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182226
AA Change: Q446*
SMART Domains Protein: ENSMUSP00000138312
Gene: ENSMUSG00000037519
AA Change: Q446*

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 389 N/A INTRINSIC
coiled coil region 411 542 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
coiled coil region 646 692 N/A INTRINSIC
low complexity region 706 728 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
SAM 909 978 5.22e-7 SMART
low complexity region 979 991 N/A INTRINSIC
SAM 1024 1091 3.89e-6 SMART
SAM 1112 1184 1.14e-7 SMART
low complexity region 1232 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182731
SMART Domains Protein: ENSMUSP00000138238
Gene: ENSMUSG00000037519

DomainStartEndE-ValueType
coiled coil region 32 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182958
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Ppfia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Ppfia1 APN 7 144481719 missense probably benign 0.00
IGL01771:Ppfia1 APN 7 144482357 missense probably benign 0.36
IGL02220:Ppfia1 APN 7 144481775 missense probably damaging 1.00
IGL02683:Ppfia1 APN 7 144513358 missense probably damaging 0.99
IGL02752:Ppfia1 APN 7 144519604 missense probably benign
PIT1430001:Ppfia1 UTSW 7 144498336 missense probably damaging 1.00
R0081:Ppfia1 UTSW 7 144504974 missense probably damaging 1.00
R0304:Ppfia1 UTSW 7 144482345 missense probably damaging 1.00
R0359:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R1836:Ppfia1 UTSW 7 144519631 missense probably benign 0.19
R1934:Ppfia1 UTSW 7 144505110 missense probably benign 0.12
R2195:Ppfia1 UTSW 7 144516107 missense probably damaging 1.00
R3759:Ppfia1 UTSW 7 144516002 missense probably benign 0.34
R3843:Ppfia1 UTSW 7 144504970 missense probably benign 0.31
R4606:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R4820:Ppfia1 UTSW 7 144498369 missense probably benign 0.33
R4898:Ppfia1 UTSW 7 144491576 missense probably damaging 1.00
R5070:Ppfia1 UTSW 7 144514473 nonsense probably null
R5076:Ppfia1 UTSW 7 144506264 missense probably damaging 1.00
R5280:Ppfia1 UTSW 7 144485095 missense possibly damaging 0.84
R5473:Ppfia1 UTSW 7 144491492 missense probably benign 0.17
R5656:Ppfia1 UTSW 7 144519974 critical splice donor site probably null
R5818:Ppfia1 UTSW 7 144520568 intron probably benign
R6104:Ppfia1 UTSW 7 144491574 missense possibly damaging 0.95
R6299:Ppfia1 UTSW 7 144510312 missense probably benign 0.11
R6474:Ppfia1 UTSW 7 144506205 missense possibly damaging 0.89
R6705:Ppfia1 UTSW 7 144519174 missense possibly damaging 0.93
R6734:Ppfia1 UTSW 7 144479053 missense probably damaging 1.00
R7062:Ppfia1 UTSW 7 144552473 missense probably benign
R7451:Ppfia1 UTSW 7 144508210 missense probably benign
R7514:Ppfia1 UTSW 7 144517713 missense probably benign 0.01
R7552:Ppfia1 UTSW 7 144506245 missense probably damaging 1.00
R7633:Ppfia1 UTSW 7 144552436 missense possibly damaging 0.89
R7886:Ppfia1 UTSW 7 144519283 missense probably benign
R8038:Ppfia1 UTSW 7 144514916 missense possibly damaging 0.67
R8139:Ppfia1 UTSW 7 144520693 missense probably damaging 1.00
R8266:Ppfia1 UTSW 7 144514494 missense possibly damaging 0.72
R8859:Ppfia1 UTSW 7 144479025 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGTGCAAGGATTCCACAG -3'
(R):5'- TACACATTGAAGCCACCGAG -3'

Sequencing Primer
(F):5'- GTGCAAGGATTCCACAGTCACAC -3'
(R):5'- ATGGATATGAGGAAGTGTTGTCC -3'
Posted On2016-06-06