Incidental Mutation 'R5069:Adcy7'
ID388551
Institutional Source Beutler Lab
Gene Symbol Adcy7
Ensembl Gene ENSMUSG00000031659
Gene Nameadenylate cyclase 7
Synonyms
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location88272403-88329962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88327697 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1060 (L1060P)
Ref Sequence ENSEMBL: ENSMUSP00000132528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034085] [ENSMUST00000098521] [ENSMUST00000168545] [ENSMUST00000169037] [ENSMUST00000171456]
Predicted Effect probably benign
Transcript: ENSMUST00000034085
SMART Domains Protein: ENSMUSP00000034085
Gene: ENSMUSG00000031660

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
low complexity region 76 96 N/A INTRINSIC
BROMO 129 237 9.72e-38 SMART
Pfam:DUF3512 287 534 2.4e-93 PFAM
coiled coil region 535 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098521
AA Change: L1060P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096122
Gene: ENSMUSG00000031659
AA Change: L1060P

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131748
Predicted Effect probably damaging
Transcript: ENSMUST00000168545
AA Change: L1060P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129252
Gene: ENSMUSG00000031659
AA Change: L1060P

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169037
AA Change: L1060P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130594
Gene: ENSMUSG00000031659
AA Change: L1060P

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171456
AA Change: L1060P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132528
Gene: ENSMUSG00000031659
AA Change: L1060P

DomainStartEndE-ValueType
low complexity region 91 104 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 1.2e-35 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210688
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound adenylate cyclase that catalyses the formation of cyclic AMP from ATP and is inhibitable by calcium. The product of this gene is a member of the adenylyl cyclase class-4/guanylyl cyclase enzyme family that is characterized by the presence of twelve membrane-spanning domains in its sequences. Several transcript variants have been observed for this gene, but the full-length natures of only two have been determined so far. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display some degree of pre- or postnatal lethality. Surviving adults for one allele appear to be normal. Heterozygous females for one allele display decreased depression related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Adcy7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Adcy7 APN 8 88318790 splice site probably benign
IGL01434:Adcy7 APN 8 88324844 missense probably damaging 1.00
IGL01784:Adcy7 APN 8 88314123 missense probably damaging 1.00
IGL02506:Adcy7 APN 8 88317943 missense probably damaging 1.00
IGL03184:Adcy7 APN 8 88308643 missense probably benign 0.00
IGL03406:Adcy7 APN 8 88318319 nonsense probably null
Churchill UTSW 8 88315759 missense probably damaging 1.00
democracy UTSW 8 88315756 missense probably damaging 1.00
Dictatorship UTSW 8 88311108 missense possibly damaging 0.80
periphery UTSW 8 88317937 missense probably benign 0.01
republic UTSW 8 88314137 missense probably damaging 1.00
tyranny UTSW 8 88312228 missense possibly damaging 0.76
PIT4283001:Adcy7 UTSW 8 88315492 missense probably damaging 1.00
PIT4453001:Adcy7 UTSW 8 88323636 missense probably benign 0.07
R0265:Adcy7 UTSW 8 88324763 missense probably damaging 0.96
R0963:Adcy7 UTSW 8 88312265 missense probably damaging 1.00
R0990:Adcy7 UTSW 8 88325452 missense possibly damaging 0.57
R1055:Adcy7 UTSW 8 88318057 splice site probably benign
R1494:Adcy7 UTSW 8 88320207 missense probably benign 0.00
R1764:Adcy7 UTSW 8 88308840 missense probably benign 0.00
R2062:Adcy7 UTSW 8 88312274 missense probably damaging 1.00
R2090:Adcy7 UTSW 8 88315857 missense probably damaging 0.98
R2201:Adcy7 UTSW 8 88317978 missense probably damaging 1.00
R2413:Adcy7 UTSW 8 88309818 missense probably benign 0.20
R2849:Adcy7 UTSW 8 88327393 missense probably benign 0.38
R4020:Adcy7 UTSW 8 88308734 missense probably benign 0.00
R4086:Adcy7 UTSW 8 88315786 missense probably benign 0.01
R4679:Adcy7 UTSW 8 88317937 missense probably benign 0.01
R5253:Adcy7 UTSW 8 88314114 missense probably damaging 1.00
R5286:Adcy7 UTSW 8 88324859 missense probably damaging 1.00
R5427:Adcy7 UTSW 8 88326201 critical splice donor site probably null
R5457:Adcy7 UTSW 8 88311021 missense probably damaging 1.00
R5689:Adcy7 UTSW 8 88324784 missense probably benign 0.00
R5907:Adcy7 UTSW 8 88312228 missense possibly damaging 0.76
R5909:Adcy7 UTSW 8 88325496 missense probably damaging 1.00
R5997:Adcy7 UTSW 8 88326392 missense probably benign 0.41
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6133:Adcy7 UTSW 8 88325439 missense possibly damaging 0.84
R6190:Adcy7 UTSW 8 88325730 splice site probably null
R6213:Adcy7 UTSW 8 88314137 missense probably damaging 1.00
R6287:Adcy7 UTSW 8 88311108 missense possibly damaging 0.80
R6502:Adcy7 UTSW 8 88325479 missense probably damaging 1.00
R6989:Adcy7 UTSW 8 88308786 missense probably benign
R7042:Adcy7 UTSW 8 88315750 missense probably damaging 0.99
R7829:Adcy7 UTSW 8 88315759 missense probably damaging 1.00
R8067:Adcy7 UTSW 8 88311069 missense probably damaging 1.00
R8113:Adcy7 UTSW 8 88321803 missense probably damaging 1.00
R8118:Adcy7 UTSW 8 88315756 missense probably damaging 1.00
R8190:Adcy7 UTSW 8 88311038 missense possibly damaging 0.49
R8402:Adcy7 UTSW 8 88308735 missense probably benign 0.30
R8421:Adcy7 UTSW 8 88322184 missense probably benign 0.06
R8549:Adcy7 UTSW 8 88326190 missense probably benign
R8827:Adcy7 UTSW 8 88309699 missense possibly damaging 0.73
X0067:Adcy7 UTSW 8 88324600 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACTGACTCTGGGAAAGACACC -3'
(R):5'- TCAAAGCCATCCTGTAGTGC -3'

Sequencing Primer
(F):5'- CCCCAGAGAAGGTATCCTGC -3'
(R):5'- CAACAGACATGGGGCTACATTCTTG -3'
Posted On2016-06-06