Mutagenetix > Incidental Mutation

Incidental Mutation 'R5069:Ube4a'

388553

Institutional Source

Beutler Lab

Gene Symbol

Ube4a

Ensembl Gene

ENSMUSG00000059890

Gene Name

ubiquitination factor E4A

Synonyms

9930123J21Rik, UFD2b, 4732444G18Rik

MMRRC Submission

042659-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44923127-44965600 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44940089 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 709 (H709R)

Ref Sequence

ENSEMBL: ENSMUSP00000112632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000145657] [ENSMUST00000154287]

AlphaFold

E9Q735

Predicted Effect

probably damaging
Transcript: ENSMUST00000117506
AA Change: H690R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890
AA Change: H690R

Domain	Start	End	E-Value	Type
low complexity region	288	299	N/A	INTRINSIC
Pfam:Ufd2P_core	330	766	2.6e-101	PFAM
Pfam:Ufd2P_core	762	935	7.4e-61	PFAM
Ubox	953	1016	1.9e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117549
AA Change: H709R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890
AA Change: H709R

Domain	Start	End	E-Value	Type
low complexity region	307	318	N/A	INTRINSIC
Pfam:Ufd2P_core	349	991	3.4e-155	PFAM
Ubox	1010	1073	1.9e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145657

Predicted Effect

probably benign
Transcript: ENSMUST00000154287

SMART Domains

Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890

Domain	Start	End	E-Value	Type
low complexity region	307	318	N/A	INTRINSIC
Pfam:Ufd2P_core	349	547	4.1e-39	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Ube4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ube4a	APN	9	44948141	missense	probably damaging	1.00
IGL00857:Ube4a	APN	9	44932386	missense	probably damaging	1.00
IGL01067:Ube4a	APN	9	44944865	missense	probably damaging	0.96
White_way	UTSW	9	44949753	nonsense	probably null
R0243:Ube4a	UTSW	9	44946178	unclassified	probably benign
R0355:Ube4a	UTSW	9	44944801	splice site	probably benign
R0680:Ube4a	UTSW	9	44948060	missense	probably damaging	1.00
R0863:Ube4a	UTSW	9	44949816	missense	possibly damaging	0.55
R0909:Ube4a	UTSW	9	44939973	missense	probably damaging	0.97
R1597:Ube4a	UTSW	9	44929766	missense	possibly damaging	0.93
R1611:Ube4a	UTSW	9	44956737	intron	probably benign
R1871:Ube4a	UTSW	9	44944937	splice site	probably null
R2069:Ube4a	UTSW	9	44948099	missense	probably damaging	0.96
R2518:Ube4a	UTSW	9	44948137	missense	probably benign	0.29
R3079:Ube4a	UTSW	9	44960073	missense	probably damaging	1.00
R3404:Ube4a	UTSW	9	44929687	missense	probably damaging	1.00
R3726:Ube4a	UTSW	9	44933323	missense	probably damaging	0.97
R3758:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4027:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4029:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4111:Ube4a	UTSW	9	44948949	missense	probably damaging	0.97
R4113:Ube4a	UTSW	9	44948949	missense	probably damaging	0.97
R4238:Ube4a	UTSW	9	44939999	missense	probably damaging	1.00
R4365:Ube4a	UTSW	9	44960081	missense	probably damaging	1.00
R4471:Ube4a	UTSW	9	44946532	unclassified	probably benign
R4793:Ube4a	UTSW	9	44948822	missense	probably damaging	1.00
R5214:Ube4a	UTSW	9	44948868	missense	probably benign	0.22
R5225:Ube4a	UTSW	9	44939960	critical splice donor site	probably null
R5416:Ube4a	UTSW	9	44941178	missense	probably damaging	0.99
R5641:Ube4a	UTSW	9	44950881	missense	probably damaging	0.99
R5729:Ube4a	UTSW	9	44933329	missense	probably damaging	1.00
R5774:Ube4a	UTSW	9	44953097	missense	probably damaging	0.99
R5908:Ube4a	UTSW	9	44948024	critical splice donor site	probably null
R6191:Ube4a	UTSW	9	44949753	nonsense	probably null
R6752:Ube4a	UTSW	9	44925948	missense	probably damaging	1.00
R6886:Ube4a	UTSW	9	44948843	missense	probably damaging	0.96
R6911:Ube4a	UTSW	9	44942758	missense	probably damaging	1.00
R7417:Ube4a	UTSW	9	44956713	missense	probably benign	0.08
R7650:Ube4a	UTSW	9	44933436	missense	probably damaging	0.99
R7747:Ube4a	UTSW	9	44925973	missense	probably damaging	1.00
R7798:Ube4a	UTSW	9	44933331	missense	probably damaging	1.00
R7842:Ube4a	UTSW	9	44949727	splice site	probably null
R7853:Ube4a	UTSW	9	44953010	missense	probably benign	0.43
R8109:Ube4a	UTSW	9	44935483	missense	probably benign	0.00
R8223:Ube4a	UTSW	9	44960035	missense	possibly damaging	0.94
R8401:Ube4a	UTSW	9	44941229	missense	possibly damaging	0.84
R8523:Ube4a	UTSW	9	44949832	missense	probably damaging	1.00
R8838:Ube4a	UTSW	9	44925963	missense	probably damaging	1.00
R9093:Ube4a	UTSW	9	44953164	missense	possibly damaging	0.66
R9314:Ube4a	UTSW	9	44942725	missense	probably benign	0.00
R9365:Ube4a	UTSW	9	44950893	missense	probably benign	0.09
R9545:Ube4a	UTSW	9	44932340	critical splice donor site	probably null
X0025:Ube4a	UTSW	9	44942818	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- ATTTCTGTGACACCCGACAGG -3'
(R):5'- ACATGGTATCTCCTGCACCG -3'

Sequencing Primer
(F):5'- AGCTGTGAAACCCTTAGCTCTCAG -3'
(R):5'- GCACCGGAGTACTGACTTTCCTATAG -3'

Posted On

2016-06-06