Incidental Mutation 'R5069:Slc5a8'
ID 388559
Institutional Source Beutler Lab
Gene Symbol Slc5a8
Ensembl Gene ENSMUSG00000020062
Gene Name solute carrier family 5 (iodide transporter), member 8
Synonyms SMCT
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5069 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 88885992-88929515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88886598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 98 (I98F)
Ref Sequence ENSEMBL: ENSMUSP00000020255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020255]
AlphaFold Q8BYF6
Predicted Effect possibly damaging
Transcript: ENSMUST00000020255
AA Change: I98F

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: I98F

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:SSF 45 449 2.6e-38 PFAM
low complexity region 462 478 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Slc5a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Slc5a8 APN 10 88908040 missense possibly damaging 0.91
IGL00902:Slc5a8 APN 10 88919461 missense probably benign 0.03
IGL00960:Slc5a8 APN 10 88921765 missense probably benign 0.21
IGL01109:Slc5a8 APN 10 88906392 missense possibly damaging 0.95
IGL01365:Slc5a8 APN 10 88892097 splice site probably benign
IGL01418:Slc5a8 APN 10 88905033 missense probably damaging 1.00
IGL01823:Slc5a8 APN 10 88919472 nonsense probably null
IGL02116:Slc5a8 APN 10 88919500 missense probably benign
IGL03109:Slc5a8 APN 10 88906416 splice site probably benign
PIT4585001:Slc5a8 UTSW 10 88886503 missense probably damaging 1.00
R0010:Slc5a8 UTSW 10 88886590 missense probably benign 0.03
R0418:Slc5a8 UTSW 10 88886558 missense probably benign 0.01
R1233:Slc5a8 UTSW 10 88918442 missense probably damaging 1.00
R1656:Slc5a8 UTSW 10 88925786 critical splice donor site probably null
R1769:Slc5a8 UTSW 10 88919464 missense probably benign
R1769:Slc5a8 UTSW 10 88919466 nonsense probably null
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2873:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R3883:Slc5a8 UTSW 10 88902463 missense possibly damaging 0.89
R4207:Slc5a8 UTSW 10 88911413 missense probably damaging 1.00
R4731:Slc5a8 UTSW 10 88925787 critical splice donor site probably null
R4880:Slc5a8 UTSW 10 88892024 missense probably damaging 1.00
R4969:Slc5a8 UTSW 10 88904912 splice site probably null
R4998:Slc5a8 UTSW 10 88908057 critical splice donor site probably null
R5009:Slc5a8 UTSW 10 88909654 missense probably benign 0.07
R5068:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5070:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5130:Slc5a8 UTSW 10 88926215 missense probably benign
R5141:Slc5a8 UTSW 10 88919560 critical splice donor site probably null
R5252:Slc5a8 UTSW 10 88906347 missense probably damaging 1.00
R5659:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5660:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5661:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6378:Slc5a8 UTSW 10 88905054 missense probably damaging 1.00
R7214:Slc5a8 UTSW 10 88919502 missense probably benign
R7255:Slc5a8 UTSW 10 88909631 missense probably damaging 1.00
R7526:Slc5a8 UTSW 10 88902491 missense probably damaging 1.00
R7604:Slc5a8 UTSW 10 88904960 missense possibly damaging 0.78
R7688:Slc5a8 UTSW 10 88921699 missense probably damaging 1.00
R7869:Slc5a8 UTSW 10 88921705 missense probably benign 0.15
R8219:Slc5a8 UTSW 10 88921699 missense probably damaging 1.00
R8474:Slc5a8 UTSW 10 88921690 missense possibly damaging 0.69
R8937:Slc5a8 UTSW 10 88905023 missense probably damaging 1.00
R8960:Slc5a8 UTSW 10 88886173 start gained probably benign
R9000:Slc5a8 UTSW 10 88926227 missense probably benign 0.00
R9000:Slc5a8 UTSW 10 88926228 missense probably benign 0.13
R9792:Slc5a8 UTSW 10 88921729 missense possibly damaging 0.55
R9795:Slc5a8 UTSW 10 88921729 missense possibly damaging 0.55
Z1177:Slc5a8 UTSW 10 88909613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGACCTCCAAGGACTTTC -3'
(R):5'- TTAGAAGCCGCATGTCTCTATGG -3'

Sequencing Primer
(F):5'- AGACCTCCAAGGACTTTCTTATGGG -3'
(R):5'- ATGTCTCTATGGGGCACACAG -3'
Posted On 2016-06-06