Incidental Mutation 'R5069:Zfc3h1'
ID388562
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Namezinc finger, C3H1-type containing
SynonymsCcdc131, Psrc2
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location115384959-115432772 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 115418783 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1427 (C1427*)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
Predicted Effect probably null
Transcript: ENSMUST00000036044
AA Change: C1427*
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: C1427*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115419832 missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115416874 missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115423448 missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115423223 missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115427099 missense probably benign
IGL02382:Zfc3h1 APN 10 115416876 nonsense probably null
IGL02397:Zfc3h1 APN 10 115407985 missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115411954 missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115400904 missense probably benign 0.42
Gnatcatcher UTSW 10 115400742 missense probably benign 0.39
vireo UTSW 10 115419901 missense probably benign 0.01
warbler UTSW 10 115406483 missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115390889 missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115427039 nonsense probably null
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115415287 missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115406725 splice site probably benign
R0355:Zfc3h1 UTSW 10 115409113 missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115420810 missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115410632 missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115401707 missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115427716 missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115411961 missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115412108 missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115416742 missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115390922 missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115406901 splice site probably null
R1959:Zfc3h1 UTSW 10 115423253 missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115406483 missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115410523 splice site probably benign
R3691:Zfc3h1 UTSW 10 115420690 missense probably benign
R3909:Zfc3h1 UTSW 10 115419901 missense probably benign 0.01
R4235:Zfc3h1 UTSW 10 115418799 missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115423385 missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115415694 missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115400742 missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115410642 missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115404211 missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5070:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5155:Zfc3h1 UTSW 10 115412121 missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115418692 missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115410693 missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115400910 missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115431357 intron probably benign
R6165:Zfc3h1 UTSW 10 115420669 missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115390859 missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115413976 missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115407908 missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115401748 missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115412002 missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115420733 missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115403300 missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115424630 missense probably benign
R7404:Zfc3h1 UTSW 10 115415248 missense probably damaging 0.96
R7667:Zfc3h1 UTSW 10 115410701 nonsense probably null
R7748:Zfc3h1 UTSW 10 115400815 missense probably benign 0.27
R7910:Zfc3h1 UTSW 10 115420683 nonsense probably null
R7991:Zfc3h1 UTSW 10 115420683 nonsense probably null
R8023:Zfc3h1 UTSW 10 115420648 missense not run
Z1176:Zfc3h1 UTSW 10 115408002 missense not run
Predicted Primers PCR Primer
(F):5'- AACGCTTTGTCCTGTCTTTGAAAC -3'
(R):5'- TGTGTTACCCCAATGTTTGAGTTTC -3'

Sequencing Primer
(F):5'- GTCCTGTCTTTGAAACATACAGGCTG -3'
(R):5'- CCCCAATGTTTGAGTTTCAGAAAG -3'
Posted On2016-06-06