Mutagenetix > Incidental Mutation

Incidental Mutation 'R5069:Arhgef28'

388570

Institutional Source

Beutler Lab

Gene Symbol

Arhgef28

Ensembl Gene

ENSMUSG00000021662

Gene Name

Rho guanine nucleotide exchange factor (GEF) 28

Synonyms

RhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2

MMRRC Submission

042659-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97899469-98206439 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98075206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 90 (T90A)

Ref Sequence

ENSEMBL: ENSMUSP00000153000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000223849] [ENSMUST00000225884]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109426
AA Change: T90A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: T90A

Domain	Start	End	E-Value	Type
low complexity region	530	568	N/A	INTRINSIC
low complexity region	634	650	N/A	INTRINSIC
C1	652	698	1.65e-11	SMART
RhoGEF	850	1040	1.11e-65	SMART
PH	1084	1187	1.08e-9	SMART
low complexity region	1267	1281	N/A	INTRINSIC
coiled coil region	1469	1522	N/A	INTRINSIC
low complexity region	1647	1663	N/A	INTRINSIC
low complexity region	1682	1693	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000223849
AA Change: T90A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225884
AA Change: T90A

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Arhgef28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Arhgef28	APN	13	97988277	missense	probably benign	0.15
IGL00945:Arhgef28	APN	13	97967399	missense	possibly damaging	0.88
IGL01099:Arhgef28	APN	13	97953972	splice site	probably benign
IGL01328:Arhgef28	APN	13	97970323	missense	probably damaging	1.00
IGL01396:Arhgef28	APN	13	97953893	missense	probably damaging	0.99
IGL02067:Arhgef28	APN	13	98077317	missense	probably damaging	1.00
IGL02147:Arhgef28	APN	13	97961314	missense	probably damaging	1.00
IGL02285:Arhgef28	APN	13	98051028	missense	possibly damaging	0.85
IGL02439:Arhgef28	APN	13	97931139	missense	possibly damaging	0.75
IGL02499:Arhgef28	APN	13	97953783	missense	possibly damaging	0.87
IGL02532:Arhgef28	APN	13	98029883	missense	probably damaging	0.99
IGL02634:Arhgef28	APN	13	98051058	missense	probably benign	0.00
IGL02902:Arhgef28	APN	13	97946875	missense	probably damaging	1.00
IGL03067:Arhgef28	APN	13	97988286	missense	probably benign	0.00
IGL03081:Arhgef28	APN	13	98029373	splice site	probably benign
IGL03106:Arhgef28	APN	13	97957793	missense	probably damaging	1.00
IGL03195:Arhgef28	APN	13	97951563	splice site	probably null
IGL03325:Arhgef28	APN	13	97899816	missense	probably benign	0.03
H8786:Arhgef28	UTSW	13	97946953	missense	probably damaging	1.00
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0090:Arhgef28	UTSW	13	98075110	missense	probably damaging	0.99
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0537:Arhgef28	UTSW	13	97957716	missense	probably damaging	1.00
R0617:Arhgef28	UTSW	13	97970355	missense	probably benign	0.21
R0711:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0723:Arhgef28	UTSW	13	97939479	missense	probably benign	0.16
R0790:Arhgef28	UTSW	13	97981406	missense	possibly damaging	0.51
R1240:Arhgef28	UTSW	13	97929492	missense	probably benign	0.00
R1365:Arhgef28	UTSW	13	98075124	missense	probably damaging	1.00
R1456:Arhgef28	UTSW	13	98075002	missense	probably benign	0.01
R1490:Arhgef28	UTSW	13	97978444	missense	probably damaging	1.00
R1496:Arhgef28	UTSW	13	97965546	missense	possibly damaging	0.93
R1660:Arhgef28	UTSW	13	97981376	missense	probably benign	0.05
R1671:Arhgef28	UTSW	13	97931034	missense	possibly damaging	0.95
R1747:Arhgef28	UTSW	13	97936824	missense	probably damaging	1.00
R1792:Arhgef28	UTSW	13	97931186	missense	probably benign	0.03
R1864:Arhgef28	UTSW	13	97994132	missense	probably benign	0.00
R1887:Arhgef28	UTSW	13	98145573	missense	probably damaging	0.97
R1924:Arhgef28	UTSW	13	97936816	splice site	probably benign
R1987:Arhgef28	UTSW	13	97967096	missense	probably benign
R2215:Arhgef28	UTSW	13	98051021	missense	possibly damaging	0.78
R2342:Arhgef28	UTSW	13	97994029	missense	probably benign	0.00
R2495:Arhgef28	UTSW	13	98029373	splice site	probably benign
R3897:Arhgef28	UTSW	13	97956576	missense	probably damaging	1.00
R3922:Arhgef28	UTSW	13	97993944	missense	possibly damaging	0.92
R4063:Arhgef28	UTSW	13	97994067	missense	probably benign	0.16
R4086:Arhgef28	UTSW	13	97967204	missense	probably damaging	0.98
R4543:Arhgef28	UTSW	13	98075000	missense	probably benign	0.00
R4730:Arhgef28	UTSW	13	97978142	missense	probably benign	0.00
R4735:Arhgef28	UTSW	13	97899729	missense	probably damaging	1.00
R4953:Arhgef28	UTSW	13	97929554	missense	possibly damaging	0.51
R5558:Arhgef28	UTSW	13	97961460	missense	probably damaging	1.00
R5573:Arhgef28	UTSW	13	97929491	missense	probably benign	0.01
R5594:Arhgef28	UTSW	13	97939492	missense	probably benign	0.00
R5937:Arhgef28	UTSW	13	97939543	missense	probably benign	0.00
R5987:Arhgef28	UTSW	13	97936860	nonsense	probably null
R6015:Arhgef28	UTSW	13	98075022	missense	possibly damaging	0.73
R6193:Arhgef28	UTSW	13	97985380	missense	probably damaging	1.00
R6209:Arhgef28	UTSW	13	97929409	critical splice donor site	probably null
R6306:Arhgef28	UTSW	13	97985388	missense	probably damaging	1.00
R6393:Arhgef28	UTSW	13	97994019	missense	possibly damaging	0.64
R6562:Arhgef28	UTSW	13	97988139	critical splice donor site	probably null
R6646:Arhgef28	UTSW	13	97939494	missense	probably benign	0.09
R6655:Arhgef28	UTSW	13	97899655	missense	probably damaging	1.00
R6707:Arhgef28	UTSW	13	97936716	missense	probably damaging	0.96
R6707:Arhgef28	UTSW	13	98075116	missense	possibly damaging	0.80
R6751:Arhgef28	UTSW	13	98075247	missense	probably damaging	0.97
R6940:Arhgef28	UTSW	13	97965530	missense	possibly damaging	0.58
R7018:Arhgef28	UTSW	13	97965435	missense	probably damaging	1.00
R7030:Arhgef28	UTSW	13	97988261	missense	possibly damaging	0.88
R7120:Arhgef28	UTSW	13	97944539	missense	probably damaging	1.00
R7266:Arhgef28	UTSW	13	97965452	missense	probably benign
R7353:Arhgef28	UTSW	13	98075202	missense	probably damaging	1.00
R7368:Arhgef28	UTSW	13	97996862	missense	probably benign	0.34
R7491:Arhgef28	UTSW	13	97944686	missense	probably benign	0.03
R7500:Arhgef28	UTSW	13	97978495	missense	probably benign	0.00
R7653:Arhgef28	UTSW	13	97969313	missense	probably benign	0.04
R7813:Arhgef28	UTSW	13	97945681	missense	possibly damaging	0.48
R7989:Arhgef28	UTSW	13	97899735	missense	probably benign
R8064:Arhgef28	UTSW	13	97978494	missense	probably benign	0.13
R8221:Arhgef28	UTSW	13	98145556	missense	probably benign	0.00
R8293:Arhgef28	UTSW	13	97942521	missense	probably benign	0.00
R8328:Arhgef28	UTSW	13	98051009	missense	possibly damaging	0.88
R8348:Arhgef28	UTSW	13	98053867	missense	possibly damaging	0.50
R8432:Arhgef28	UTSW	13	97951583	missense	probably benign	0.29
R8843:Arhgef28	UTSW	13	97994049	missense	probably benign
R8859:Arhgef28	UTSW	13	97945702	missense	probably damaging	1.00
R8954:Arhgef28	UTSW	13	97929633	missense	probably benign	0.03
R8987:Arhgef28	UTSW	13	98053964	missense	possibly damaging	0.87
R9253:Arhgef28	UTSW	13	97988271	missense	probably benign	0.09
R9351:Arhgef28	UTSW	13	97994068	missense	probably benign	0.11
R9381:Arhgef28	UTSW	13	97899761	missense	possibly damaging	0.60
R9395:Arhgef28	UTSW	13	97967184	frame shift	probably null
R9466:Arhgef28	UTSW	13	97988317	missense
R9529:Arhgef28	UTSW	13	98077265	missense	probably damaging	1.00
R9641:Arhgef28	UTSW	13	97942475	missense	probably benign	0.00
R9662:Arhgef28	UTSW	13	97929461	missense	probably benign	0.20
R9744:Arhgef28	UTSW	13	97957753	missense	probably damaging	1.00
R9776:Arhgef28	UTSW	13	97996907	missense	probably benign	0.19
Z1088:Arhgef28	UTSW	13	97945691	missense	probably damaging	1.00
Z1177:Arhgef28	UTSW	13	97899756	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- CACTGACCTACCTTCAAGTGAG -3'
(R):5'- AAAGATGGTGCTTGTTCCCTG -3'

Sequencing Primer
(F):5'- CCTTCAAGTGAGGAATTTCCCAGG -3'
(R):5'- TTCCCTGGAGAGTGCTGC -3'

Posted On

2016-06-06