Incidental Mutation 'R5069:Krt75'
ID388579
Institutional Source Beutler Lab
Gene Symbol Krt75
Ensembl Gene ENSMUSG00000022986
Gene Namekeratin 75
SynonymsKrt2-6hf, 4732468K03Rik, K6hf, Krtcap1
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101563345-101573904 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 101566238 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023714] [ENSMUST00000042957]
Predicted Effect probably benign
Transcript: ENSMUST00000023714
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042957
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196179
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-in mutation that results in the deletion of the highly conserved asparagine residue (N159) in the helix initiation peptide of this gene develop hair shaft and nail abnormalities resembling pachyonychia congenita. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Krt75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Krt75 APN 15 101572646 missense probably benign
IGL01406:Krt75 APN 15 101568025 missense probably damaging 1.00
IGL01783:Krt75 APN 15 101564929 missense probably benign 0.01
IGL01911:Krt75 APN 15 101568102 missense probably damaging 1.00
IGL01945:Krt75 APN 15 101570164 missense possibly damaging 0.56
IGL02178:Krt75 APN 15 101572791 missense probably benign 0.00
IGL02832:Krt75 APN 15 101568073 missense probably benign 0.02
IGL03173:Krt75 APN 15 101572727 missense probably damaging 1.00
IGL03276:Krt75 APN 15 101568376 missense probably damaging 0.98
BB007:Krt75 UTSW 15 101564883 makesense probably null
BB017:Krt75 UTSW 15 101564883 makesense probably null
R0482:Krt75 UTSW 15 101570311 missense probably benign 0.22
R0595:Krt75 UTSW 15 101568354 missense probably damaging 1.00
R0626:Krt75 UTSW 15 101573590 missense probably benign 0.05
R1495:Krt75 UTSW 15 101573873 start gained probably benign
R1886:Krt75 UTSW 15 101571097 missense probably damaging 0.97
R1906:Krt75 UTSW 15 101573366 missense possibly damaging 0.66
R1907:Krt75 UTSW 15 101573366 missense possibly damaging 0.66
R2055:Krt75 UTSW 15 101572761 missense probably benign 0.08
R2504:Krt75 UTSW 15 101568031 missense probably benign 0.27
R2930:Krt75 UTSW 15 101568031 missense probably benign 0.27
R3788:Krt75 UTSW 15 101573521 missense possibly damaging 0.94
R4494:Krt75 UTSW 15 101571701 nonsense probably null
R4803:Krt75 UTSW 15 101568072 missense probably benign 0.00
R4868:Krt75 UTSW 15 101568121 missense probably damaging 1.00
R4906:Krt75 UTSW 15 101570239 missense probably damaging 1.00
R4969:Krt75 UTSW 15 101573813 missense probably benign
R5446:Krt75 UTSW 15 101571067 missense probably null 0.22
R6019:Krt75 UTSW 15 101573723 missense probably benign 0.00
R6739:Krt75 UTSW 15 101571068 missense probably benign 0.00
R6835:Krt75 UTSW 15 101571037 missense probably benign 0.16
R7167:Krt75 UTSW 15 101568315 missense possibly damaging 0.90
R7622:Krt75 UTSW 15 101570272 missense probably damaging 1.00
R7930:Krt75 UTSW 15 101564883 makesense probably null
R8046:Krt75 UTSW 15 101572764 missense probably benign 0.01
R8943:Krt75 UTSW 15 101568332 missense probably benign 0.03
X0022:Krt75 UTSW 15 101570213 missense possibly damaging 0.94
Z1088:Krt75 UTSW 15 101573665 missense probably benign 0.00
Z1177:Krt75 UTSW 15 101571054 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGCTCTAGGTTCAACTCC -3'
(R):5'- GTTTTAAACCTGCATGACTTCTTGC -3'

Sequencing Primer
(F):5'- GCTCTAGGTTCAACTCCCAACAC -3'
(R):5'- AGTGACAACCTGGACCAA -3'
Posted On2016-06-06