Incidental Mutation 'R5069:Krt75'
ID 388579
Institutional Source Beutler Lab
Gene Symbol Krt75
Ensembl Gene ENSMUSG00000022986
Gene Name keratin 75
Synonyms Krt2-6hf, Krtcap1, 4732468K03Rik, K6hf
MMRRC Submission 042659-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5069 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101471780-101482339 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 101474673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023714] [ENSMUST00000042957]
AlphaFold Q8BGZ7
Predicted Effect probably benign
Transcript: ENSMUST00000023714
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042957
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196179
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-in mutation that results in the deletion of the highly conserved asparagine residue (N159) in the helix initiation peptide of this gene develop hair shaft and nail abnormalities resembling pachyonychia congenita. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
AAdacl4fm3 T A 4: 144,430,437 (GRCm39) D184V probably damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Adcy7 T C 8: 89,054,325 (GRCm39) L1060P probably damaging Het
Aff3 A G 1: 38,220,694 (GRCm39) probably null Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd27 A T 7: 35,327,860 (GRCm39) K793N probably damaging Het
Arhgef28 T C 13: 98,211,714 (GRCm39) T90A probably damaging Het
Armc9 A T 1: 86,184,959 (GRCm39) H670L probably benign Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Ass1 C T 2: 31,400,185 (GRCm39) T301M probably damaging Het
Baiap3 A T 17: 25,468,082 (GRCm39) C283S probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cdh3 A G 8: 107,263,458 (GRCm39) N126S probably benign Het
Cfap54 A C 10: 92,773,636 (GRCm39) F135L probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Elapor2 T A 5: 9,490,897 (GRCm39) C636S probably damaging Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Firrm T C 1: 163,815,243 (GRCm39) T93A possibly damaging Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gm1043 T G 5: 37,344,580 (GRCm39) L231R probably damaging Het
Gpr153 T A 4: 152,364,340 (GRCm39) M132K probably damaging Het
Hbs1l T A 10: 21,230,546 (GRCm39) S496T probably damaging Het
Inpp5f A G 7: 128,278,451 (GRCm39) probably null Het
Kat6a G A 8: 23,393,149 (GRCm39) C209Y probably damaging Het
Kcna2 T A 3: 107,011,953 (GRCm39) V178D probably damaging Het
Letm2 G A 8: 26,083,980 (GRCm39) Q84* probably null Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Muc6 A G 7: 141,237,564 (GRCm39) C218R probably damaging Het
Myof A T 19: 37,893,773 (GRCm39) I1130N possibly damaging Het
Neil3 A G 8: 54,054,076 (GRCm39) S318P possibly damaging Het
Nhlh1 A G 1: 171,881,467 (GRCm39) V133A probably benign Het
Nup153 A C 13: 46,863,268 (GRCm39) S331A probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or9s23 T A 1: 92,501,135 (GRCm39) S81T probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pald1 A T 10: 61,177,025 (GRCm39) M675K possibly damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pitpnm1 C T 19: 4,161,140 (GRCm39) A897V probably benign Het
Plxnd1 A T 6: 115,942,862 (GRCm39) V1274E probably damaging Het
Polr2a T C 11: 69,627,561 (GRCm39) probably null Het
Ppfia1 G A 7: 144,068,210 (GRCm39) Q446* probably null Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Pwwp4a T C X: 72,171,577 (GRCm39) I323T probably damaging Het
Rhbdl2 T A 4: 123,711,710 (GRCm39) L149* probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rtel1 G A 2: 180,997,285 (GRCm39) V1042M probably benign Het
Sidt2 A T 9: 45,850,759 (GRCm39) probably null Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc28a2b A T 2: 122,324,854 (GRCm39) N142I possibly damaging Het
Slc4a10 G A 2: 62,097,915 (GRCm39) R508H probably benign Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slf2 T A 19: 44,923,692 (GRCm39) S169T possibly damaging Het
Snx33 A T 9: 56,833,475 (GRCm39) I198N probably damaging Het
Spock3 A G 8: 63,808,299 (GRCm39) T396A probably benign Het
Sva A T 6: 42,015,351 (GRCm39) probably benign Het
Syt7 A G 19: 10,416,601 (GRCm39) N261S probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Thoc2 C T X: 40,895,570 (GRCm39) E1491K probably damaging Het
Tlr1 T C 5: 65,083,743 (GRCm39) Y278C probably benign Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Trpm4 T G 7: 44,959,893 (GRCm39) Y667S probably damaging Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Ube4a T C 9: 44,851,387 (GRCm39) H709R probably damaging Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wars2 A G 3: 99,094,849 (GRCm39) H48R probably damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Other mutations in Krt75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Krt75 APN 15 101,481,081 (GRCm39) missense probably benign
IGL01406:Krt75 APN 15 101,476,460 (GRCm39) missense probably damaging 1.00
IGL01783:Krt75 APN 15 101,473,364 (GRCm39) missense probably benign 0.01
IGL01911:Krt75 APN 15 101,476,537 (GRCm39) missense probably damaging 1.00
IGL01945:Krt75 APN 15 101,478,599 (GRCm39) missense possibly damaging 0.56
IGL02178:Krt75 APN 15 101,481,226 (GRCm39) missense probably benign 0.00
IGL02832:Krt75 APN 15 101,476,508 (GRCm39) missense probably benign 0.02
IGL03173:Krt75 APN 15 101,481,162 (GRCm39) missense probably damaging 1.00
IGL03276:Krt75 APN 15 101,476,811 (GRCm39) missense probably damaging 0.98
BB007:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
BB017:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
R0482:Krt75 UTSW 15 101,478,746 (GRCm39) missense probably benign 0.22
R0595:Krt75 UTSW 15 101,476,789 (GRCm39) missense probably damaging 1.00
R0626:Krt75 UTSW 15 101,482,025 (GRCm39) missense probably benign 0.05
R1495:Krt75 UTSW 15 101,482,308 (GRCm39) start gained probably benign
R1886:Krt75 UTSW 15 101,479,532 (GRCm39) missense probably damaging 0.97
R1906:Krt75 UTSW 15 101,481,801 (GRCm39) missense possibly damaging 0.66
R1907:Krt75 UTSW 15 101,481,801 (GRCm39) missense possibly damaging 0.66
R2055:Krt75 UTSW 15 101,481,196 (GRCm39) missense probably benign 0.08
R2504:Krt75 UTSW 15 101,476,466 (GRCm39) missense probably benign 0.27
R2930:Krt75 UTSW 15 101,476,466 (GRCm39) missense probably benign 0.27
R3788:Krt75 UTSW 15 101,481,956 (GRCm39) missense possibly damaging 0.94
R4494:Krt75 UTSW 15 101,480,136 (GRCm39) nonsense probably null
R4803:Krt75 UTSW 15 101,476,507 (GRCm39) missense probably benign 0.00
R4868:Krt75 UTSW 15 101,476,556 (GRCm39) missense probably damaging 1.00
R4906:Krt75 UTSW 15 101,478,674 (GRCm39) missense probably damaging 1.00
R4969:Krt75 UTSW 15 101,482,248 (GRCm39) missense probably benign
R5446:Krt75 UTSW 15 101,479,502 (GRCm39) missense probably null 0.22
R6019:Krt75 UTSW 15 101,482,158 (GRCm39) missense probably benign 0.00
R6739:Krt75 UTSW 15 101,479,503 (GRCm39) missense probably benign 0.00
R6835:Krt75 UTSW 15 101,479,472 (GRCm39) missense probably benign 0.16
R7167:Krt75 UTSW 15 101,476,750 (GRCm39) missense possibly damaging 0.90
R7622:Krt75 UTSW 15 101,478,707 (GRCm39) missense probably damaging 1.00
R7930:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
R8046:Krt75 UTSW 15 101,481,199 (GRCm39) missense probably benign 0.01
R8943:Krt75 UTSW 15 101,476,767 (GRCm39) missense probably benign 0.03
R9360:Krt75 UTSW 15 101,476,729 (GRCm39) missense probably damaging 1.00
R9483:Krt75 UTSW 15 101,482,238 (GRCm39) missense probably benign 0.01
R9609:Krt75 UTSW 15 101,474,677 (GRCm39) missense probably benign 0.33
X0022:Krt75 UTSW 15 101,478,648 (GRCm39) missense possibly damaging 0.94
Z1088:Krt75 UTSW 15 101,482,100 (GRCm39) missense probably benign 0.00
Z1177:Krt75 UTSW 15 101,479,489 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGCTCTAGGTTCAACTCC -3'
(R):5'- GTTTTAAACCTGCATGACTTCTTGC -3'

Sequencing Primer
(F):5'- GCTCTAGGTTCAACTCCCAACAC -3'
(R):5'- AGTGACAACCTGGACCAA -3'
Posted On 2016-06-06