Mutagenetix > Incidental Mutation

Incidental Mutation 'R5069:Krt75'

388579

Institutional Source

Beutler Lab

Gene Symbol

Krt75

Ensembl Gene

ENSMUSG00000022986

Gene Name

keratin 75

Synonyms

Krt2-6hf, 4732468K03Rik, K6hf, Krtcap1

MMRRC Submission

042659-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101563345-101573904 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 101566238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023714] [ENSMUST00000042957]

AlphaFold

Q8BGZ7

Predicted Effect

probably benign
Transcript: ENSMUST00000023714

SMART Domains

Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	139	3.1e-24	PFAM
Filament	142	453	1.05e-179	SMART
low complexity region	465	522	N/A	INTRINSIC
low complexity region	527	535	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000042957

SMART Domains

Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	146	1e-32	PFAM
Filament	149	462	1.68e-178	SMART
low complexity region	468	527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196179

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-in mutation that results in the deletion of the highly conserved asparagine residue (N159) in the helix initiation peptide of this gene develop hair shaft and nail abnormalities resembling pachyonychia congenita. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Krt75

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Krt75	APN	15	101572646	missense	probably benign
IGL01406:Krt75	APN	15	101568025	missense	probably damaging	1.00
IGL01783:Krt75	APN	15	101564929	missense	probably benign	0.01
IGL01911:Krt75	APN	15	101568102	missense	probably damaging	1.00
IGL01945:Krt75	APN	15	101570164	missense	possibly damaging	0.56
IGL02178:Krt75	APN	15	101572791	missense	probably benign	0.00
IGL02832:Krt75	APN	15	101568073	missense	probably benign	0.02
IGL03173:Krt75	APN	15	101572727	missense	probably damaging	1.00
IGL03276:Krt75	APN	15	101568376	missense	probably damaging	0.98
BB007:Krt75	UTSW	15	101564883	makesense	probably null
BB017:Krt75	UTSW	15	101564883	makesense	probably null
R0482:Krt75	UTSW	15	101570311	missense	probably benign	0.22
R0595:Krt75	UTSW	15	101568354	missense	probably damaging	1.00
R0626:Krt75	UTSW	15	101573590	missense	probably benign	0.05
R1495:Krt75	UTSW	15	101573873	start gained	probably benign
R1886:Krt75	UTSW	15	101571097	missense	probably damaging	0.97
R1906:Krt75	UTSW	15	101573366	missense	possibly damaging	0.66
R1907:Krt75	UTSW	15	101573366	missense	possibly damaging	0.66
R2055:Krt75	UTSW	15	101572761	missense	probably benign	0.08
R2504:Krt75	UTSW	15	101568031	missense	probably benign	0.27
R2930:Krt75	UTSW	15	101568031	missense	probably benign	0.27
R3788:Krt75	UTSW	15	101573521	missense	possibly damaging	0.94
R4494:Krt75	UTSW	15	101571701	nonsense	probably null
R4803:Krt75	UTSW	15	101568072	missense	probably benign	0.00
R4868:Krt75	UTSW	15	101568121	missense	probably damaging	1.00
R4906:Krt75	UTSW	15	101570239	missense	probably damaging	1.00
R4969:Krt75	UTSW	15	101573813	missense	probably benign
R5446:Krt75	UTSW	15	101571067	missense	probably null	0.22
R6019:Krt75	UTSW	15	101573723	missense	probably benign	0.00
R6739:Krt75	UTSW	15	101571068	missense	probably benign	0.00
R6835:Krt75	UTSW	15	101571037	missense	probably benign	0.16
R7167:Krt75	UTSW	15	101568315	missense	possibly damaging	0.90
R7622:Krt75	UTSW	15	101570272	missense	probably damaging	1.00
R7930:Krt75	UTSW	15	101564883	makesense	probably null
R8046:Krt75	UTSW	15	101572764	missense	probably benign	0.01
R8943:Krt75	UTSW	15	101568332	missense	probably benign	0.03
R9360:Krt75	UTSW	15	101568294	missense	probably damaging	1.00
R9483:Krt75	UTSW	15	101573803	missense	probably benign	0.01
R9609:Krt75	UTSW	15	101566242	missense	probably benign	0.33
X0022:Krt75	UTSW	15	101570213	missense	possibly damaging	0.94
Z1088:Krt75	UTSW	15	101573665	missense	probably benign	0.00
Z1177:Krt75	UTSW	15	101571054	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGGCTCTAGGTTCAACTCC -3'
(R):5'- GTTTTAAACCTGCATGACTTCTTGC -3'

Sequencing Primer
(F):5'- GCTCTAGGTTCAACTCCCAACAC -3'
(R):5'- AGTGACAACCTGGACCAA -3'

Posted On

2016-06-06