Incidental Mutation 'R5069:Dlg1'
ID 388582
Institutional Source Beutler Lab
Gene Symbol Dlg1
Ensembl Gene ENSMUSG00000022770
Gene Name discs large MAGUK scaffold protein 1
Synonyms Dlgh1, B130052P05Rik, SAP97
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5069 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 31663443-31875129 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 31684295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023454] [ENSMUST00000023454] [ENSMUST00000064477] [ENSMUST00000100001] [ENSMUST00000100001] [ENSMUST00000115201] [ENSMUST00000115201] [ENSMUST00000115205] [ENSMUST00000132176]
AlphaFold Q811D0
Predicted Effect probably null
Transcript: ENSMUST00000023454
SMART Domains Protein: ENSMUSP00000023454
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 441 514 1.84e-22 SMART
low complexity region 534 542 N/A INTRINSIC
SH3 551 617 1.27e-9 SMART
GuKc 681 860 1.54e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000023454
SMART Domains Protein: ENSMUSP00000023454
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 441 514 1.84e-22 SMART
low complexity region 534 542 N/A INTRINSIC
SH3 551 617 1.27e-9 SMART
GuKc 681 860 1.54e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000064477
SMART Domains Protein: ENSMUSP00000064280
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 736 915 1.54e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100001
SMART Domains Protein: ENSMUSP00000097581
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100001
SMART Domains Protein: ENSMUSP00000097581
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115201
SMART Domains Protein: ENSMUSP00000110855
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 721 900 1.54e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115201
SMART Domains Protein: ENSMUSP00000110855
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 721 900 1.54e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115205
SMART Domains Protein: ENSMUSP00000110859
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132176
SMART Domains Protein: ENSMUSP00000138782
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 426 499 1.84e-22 SMART
low complexity region 519 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232316
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain scaffolding protein that is required for normal development. This protein may have a role in septate junction formation, signal transduction, cell proliferation, synaptogenesis and lymphocyte activation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene, but the full-length nature of some of the variants is not known. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal lethality, craniofacial defects, and abnormal eye morphology. Mice homozygous for knock-out alleles exhibit neonatal lethality, kidney defects, reproductive organ morphology, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Dlg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Dlg1 APN 16 31856438 splice site probably benign
IGL02277:Dlg1 APN 16 31790264 missense probably damaging 1.00
IGL02897:Dlg1 APN 16 31771856 critical splice donor site probably null
IGL03025:Dlg1 APN 16 31805727 missense probably benign 0.00
IGL03271:Dlg1 APN 16 31857892 missense possibly damaging 0.94
PIT4812001:Dlg1 UTSW 16 31846885 missense probably benign 0.01
R0068:Dlg1 UTSW 16 31836200 unclassified probably benign
R0115:Dlg1 UTSW 16 31805690 nonsense probably null
R0128:Dlg1 UTSW 16 31858065 critical splice donor site probably null
R0257:Dlg1 UTSW 16 31842853 splice site probably benign
R0268:Dlg1 UTSW 16 31684193 missense probably benign
R0312:Dlg1 UTSW 16 31790267 missense probably benign
R0321:Dlg1 UTSW 16 31858036 missense probably damaging 1.00
R0355:Dlg1 UTSW 16 31684174 nonsense probably null
R0538:Dlg1 UTSW 16 31796864 critical splice acceptor site probably null
R0540:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0607:Dlg1 UTSW 16 31665580 missense probably benign 0.37
R0607:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0894:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R1107:Dlg1 UTSW 16 31846916 missense probably benign 0.00
R1349:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1372:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1696:Dlg1 UTSW 16 31781798 missense probably damaging 0.96
R1772:Dlg1 UTSW 16 31665667 missense possibly damaging 0.75
R1795:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R2106:Dlg1 UTSW 16 31812756 missense probably damaging 1.00
R2206:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2207:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2846:Dlg1 UTSW 16 31863197 missense probably damaging 1.00
R3954:Dlg1 UTSW 16 31858008 missense probably damaging 1.00
R4714:Dlg1 UTSW 16 31790261 missense probably damaging 1.00
R4758:Dlg1 UTSW 16 31791752 missense possibly damaging 0.92
R4898:Dlg1 UTSW 16 31857946 missense probably damaging 1.00
R4964:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4966:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4985:Dlg1 UTSW 16 31788135 splice site probably null
R5068:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5078:Dlg1 UTSW 16 31856469 nonsense probably null
R5090:Dlg1 UTSW 16 31838084 missense probably damaging 1.00
R5225:Dlg1 UTSW 16 31836267 missense probably benign 0.21
R5888:Dlg1 UTSW 16 31791886 critical splice donor site probably null
R5950:Dlg1 UTSW 16 31665583 missense probably damaging 1.00
R6029:Dlg1 UTSW 16 31793570 missense probably damaging 1.00
R6132:Dlg1 UTSW 16 31836241 missense possibly damaging 0.93
R6246:Dlg1 UTSW 16 31665650 missense probably benign 0.00
R6294:Dlg1 UTSW 16 31838124 missense probably damaging 1.00
R6322:Dlg1 UTSW 16 31856479 missense probably damaging 1.00
R7147:Dlg1 UTSW 16 31791854 missense probably benign
R7216:Dlg1 UTSW 16 31796918 frame shift probably null
R7963:Dlg1 UTSW 16 31790301 missense probably null 0.92
R7985:Dlg1 UTSW 16 31788105 nonsense probably null
R8041:Dlg1 UTSW 16 31838067 missense possibly damaging 0.91
R8111:Dlg1 UTSW 16 31842802 missense possibly damaging 0.79
R8751:Dlg1 UTSW 16 31781830 missense probably benign
R9052:Dlg1 UTSW 16 31838124 missense probably damaging 1.00
R9674:Dlg1 UTSW 16 31791762 missense probably damaging 0.98
R9725:Dlg1 UTSW 16 31846865 missense probably benign 0.44
R9741:Dlg1 UTSW 16 31857917 nonsense probably null
X0021:Dlg1 UTSW 16 31665708 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCTAAGACTTGCCTTGCAGG -3'
(R):5'- TTTCTGAGATCTACCACCAAGACAC -3'

Sequencing Primer
(F):5'- TTGATCCCAGCACTTGAGAG -3'
(R):5'- GATCTACCACCAAGACACTAATTTC -3'
Posted On 2016-06-06