Incidental Mutation 'R5069:Vwa7'
ID388586
Institutional Source Beutler Lab
Gene Symbol Vwa7
Ensembl Gene ENSMUSG00000007030
Gene Namevon Willebrand factor A domain containing 7
SynonymsD17H6S56E-3, G7c
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35016579-35026741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35024190 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 615 (V615I)
Ref Sequence ENSEMBL: ENSMUSP00000133418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000007250] [ENSMUST00000040151] [ENSMUST00000097338] [ENSMUST00000172499] [ENSMUST00000172536] [ENSMUST00000174037] [ENSMUST00000174117] [ENSMUST00000174603]
Predicted Effect probably benign
Transcript: ENSMUST00000007245
AA Change: V636I

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030
AA Change: V636I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000007250
SMART Domains Protein: ENSMUSP00000007250
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000040151
SMART Domains Protein: ENSMUSP00000047448
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
Pfam:Suppressor_APC 35 114 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097338
SMART Domains Protein: ENSMUSP00000094951
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172499
AA Change: V615I

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030
AA Change: V615I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172536
SMART Domains Protein: ENSMUSP00000134426
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
low complexity region 604 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173211
Predicted Effect probably benign
Transcript: ENSMUST00000174026
SMART Domains Protein: ENSMUSP00000134295
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
MUTSac 1 166 4e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174037
SMART Domains Protein: ENSMUSP00000133881
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174117
SMART Domains Protein: ENSMUSP00000134423
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174603
SMART Domains Protein: ENSMUSP00000134065
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 493 1.67e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Vwa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Vwa7 APN 17 35024942 missense probably damaging 1.00
IGL01736:Vwa7 APN 17 35019851 missense probably damaging 1.00
IGL01868:Vwa7 APN 17 35021259 missense probably null 0.96
IGL01920:Vwa7 APN 17 35024603 missense probably benign 0.01
IGL02227:Vwa7 APN 17 35020084 missense probably damaging 1.00
IGL02947:Vwa7 APN 17 35023500 splice site probably null
IGL03259:Vwa7 APN 17 35020026 splice site probably null
IGL03263:Vwa7 APN 17 35021599 missense probably benign 0.16
R0008:Vwa7 UTSW 17 35019805 missense probably benign 0.33
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0418:Vwa7 UTSW 17 35017957 missense possibly damaging 0.57
R0538:Vwa7 UTSW 17 35022651 missense probably damaging 1.00
R1121:Vwa7 UTSW 17 35017794 missense probably damaging 1.00
R1659:Vwa7 UTSW 17 35019071 missense probably benign 0.04
R1766:Vwa7 UTSW 17 35023943 critical splice donor site probably null
R1777:Vwa7 UTSW 17 35024948 missense probably damaging 1.00
R1793:Vwa7 UTSW 17 35024412 nonsense probably null
R1874:Vwa7 UTSW 17 35017112 missense probably benign 0.00
R2139:Vwa7 UTSW 17 35023430 missense probably benign 0.00
R2248:Vwa7 UTSW 17 35019043 missense probably benign 0.04
R2290:Vwa7 UTSW 17 35017211 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2873:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2874:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R3038:Vwa7 UTSW 17 35022661 missense probably damaging 1.00
R3792:Vwa7 UTSW 17 35025159 splice site probably null
R3970:Vwa7 UTSW 17 35017708 missense probably damaging 1.00
R4612:Vwa7 UTSW 17 35023450 missense probably damaging 0.96
R5013:Vwa7 UTSW 17 35022733 missense probably damaging 1.00
R5068:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5070:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5137:Vwa7 UTSW 17 35017846 missense probably damaging 1.00
R5384:Vwa7 UTSW 17 35024926 splice site probably null
R6170:Vwa7 UTSW 17 35021210 missense possibly damaging 0.56
R6229:Vwa7 UTSW 17 35024265 missense probably benign 0.00
R6249:Vwa7 UTSW 17 35023389 missense probably benign 0.00
R6401:Vwa7 UTSW 17 35017310 splice site probably null
R6429:Vwa7 UTSW 17 35024199 missense probably benign 0.32
R6678:Vwa7 UTSW 17 35019800 missense probably damaging 1.00
R6793:Vwa7 UTSW 17 35024891 missense probably benign 0.06
R6966:Vwa7 UTSW 17 35017096 missense probably benign
R7492:Vwa7 UTSW 17 35019044 missense possibly damaging 0.86
R7903:Vwa7 UTSW 17 35017787 missense probably damaging 1.00
R7922:Vwa7 UTSW 17 35024433 missense possibly damaging 0.81
R8191:Vwa7 UTSW 17 35019736 missense probably damaging 0.96
R8728:Vwa7 UTSW 17 35017157 missense probably damaging 1.00
R8961:Vwa7 UTSW 17 35019110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGATGAGTAAAGCATGCTAGGG -3'
(R):5'- AGAAATCTGGAGGGCCACTC -3'

Sequencing Primer
(F):5'- CTAGGGAGAGTCCAGCTTCATG -3'
(R):5'- CACTCAGCTGCAGGGAAG -3'
Posted On2016-06-06