Incidental Mutation 'R5069:Pitpnm1'
ID388592
Institutional Source Beutler Lab
Gene Symbol Pitpnm1
Ensembl Gene ENSMUSG00000024851
Gene Namephosphatidylinositol transfer protein, membrane-associated 1
SynonymsDRES9, RdgB
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4099998-4113965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4111140 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 897 (A897V)
Ref Sequence ENSEMBL: ENSMUSP00000097599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025767] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000117831] [ENSMUST00000121402]
Predicted Effect probably benign
Transcript: ENSMUST00000025767
SMART Domains Protein: ENSMUSP00000025767
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 5.3e-11 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000049658
AA Change: A897V

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851
AA Change: A897V

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 2e-145 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100022
AA Change: A897V

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851
AA Change: A897V

DomainStartEndE-ValueType
Pfam:IP_trans 1 250 1.6e-113 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117831
SMART Domains Protein: ENSMUSP00000113807
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1e-10 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121402
SMART Domains Protein: ENSMUSP00000114096
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145915
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM1 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male-specific decrease in circulating cholesterol and circulating calcium levels and female-specific decreased leukocyte cell numbers and a slight increase in auditory brainstem response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Pitpnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pitpnm1 APN 19 4110665 splice site probably null
IGL00978:Pitpnm1 APN 19 4101228 missense possibly damaging 0.61
IGL02039:Pitpnm1 APN 19 4105032 missense probably benign 0.01
IGL02122:Pitpnm1 APN 19 4107796 missense probably damaging 1.00
IGL02279:Pitpnm1 APN 19 4101207 missense probably damaging 1.00
IGL02316:Pitpnm1 APN 19 4112835 missense probably benign 0.16
IGL02434:Pitpnm1 APN 19 4103377 missense probably benign 0.00
R0926:Pitpnm1 UTSW 19 4112338 missense probably damaging 1.00
R1301:Pitpnm1 UTSW 19 4110831 splice site probably null
R1423:Pitpnm1 UTSW 19 4112392 missense probably damaging 1.00
R1592:Pitpnm1 UTSW 19 4106964 critical splice donor site probably null
R1733:Pitpnm1 UTSW 19 4109960 nonsense probably null
R1844:Pitpnm1 UTSW 19 4112395 missense probably damaging 1.00
R1971:Pitpnm1 UTSW 19 4112450 missense probably damaging 1.00
R1978:Pitpnm1 UTSW 19 4107973 splice site probably null
R2016:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2017:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2019:Pitpnm1 UTSW 19 4113641 missense probably damaging 1.00
R2210:Pitpnm1 UTSW 19 4105253 missense probably damaging 1.00
R2393:Pitpnm1 UTSW 19 4110935 missense probably benign 0.02
R3434:Pitpnm1 UTSW 19 4112234 missense probably damaging 1.00
R3439:Pitpnm1 UTSW 19 4112752 missense probably benign 0.00
R4554:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4555:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4557:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4831:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R4874:Pitpnm1 UTSW 19 4112252 critical splice donor site probably null
R5058:Pitpnm1 UTSW 19 4112758 missense probably benign 0.00
R5249:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R5288:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5385:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5619:Pitpnm1 UTSW 19 4103270 missense probably damaging 1.00
R5650:Pitpnm1 UTSW 19 4103319 missense possibly damaging 0.78
R6267:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6341:Pitpnm1 UTSW 19 4102829 nonsense probably null
R6608:Pitpnm1 UTSW 19 4110875 missense probably damaging 1.00
R6739:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6915:Pitpnm1 UTSW 19 4106947 missense possibly damaging 0.95
R7141:Pitpnm1 UTSW 19 4102787 missense probably damaging 0.97
R7751:Pitpnm1 UTSW 19 4103470 missense probably benign 0.02
R8057:Pitpnm1 UTSW 19 4112145 missense probably null 0.71
R8210:Pitpnm1 UTSW 19 4112878 critical splice donor site probably null
R8415:Pitpnm1 UTSW 19 4105454 missense probably benign 0.37
R8462:Pitpnm1 UTSW 19 4105135 missense probably benign 0.03
R8808:Pitpnm1 UTSW 19 4112356 missense possibly damaging 0.94
R9060:Pitpnm1 UTSW 19 4106869 missense probably damaging 0.96
Z1177:Pitpnm1 UTSW 19 4105009 missense probably benign
Z1177:Pitpnm1 UTSW 19 4109996 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATGTAGTGGCCTTCATTCTGCG -3'
(R):5'- AAGCTTCCTGGCAGTCAGAG -3'

Sequencing Primer
(F):5'- CTTCATTCTGCGCCAGGTGAG -3'
(R):5'- TTCCTGGCAGTCAGAGCAGAC -3'
Posted On2016-06-06