Mutagenetix > Incidental Mutation

Incidental Mutation 'R5069:Syt7'

388593

Institutional Source

Beutler Lab

Gene Symbol

Syt7

Ensembl Gene

ENSMUSG00000024743

Gene Name

synaptotagmin VII

Synonyms

MMRRC Submission

042659-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10389090-10453181 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10439237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 261 (N261S)

Ref Sequence

ENSEMBL: ENSMUSP00000153132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073899] [ENSMUST00000076968] [ENSMUST00000169121] [ENSMUST00000223586] [ENSMUST00000224135]

AlphaFold

Q9R0N7

Predicted Effect

probably benign
Transcript: ENSMUST00000073899
AA Change: N146S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073560
Gene: ENSMUSG00000024743
AA Change: N146S

Domain	Start	End	E-Value	Type
transmembrane domain	18	40	N/A	INTRINSIC
C2	151	254	3.29e-25	SMART
low complexity region	261	274	N/A	INTRINSIC
C2	282	396	4.98e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000076968
AA Change: N354S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000076234
Gene: ENSMUSG00000024743
AA Change: N354S

Domain	Start	End	E-Value	Type
transmembrane domain	18	40	N/A	INTRINSIC
C2	195	298	3.29e-25	SMART
low complexity region	305	318	N/A	INTRINSIC
C2	326	440	4.98e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169121
AA Change: N310S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000127973
Gene: ENSMUSG00000024743
AA Change: N310S

Domain	Start	End	E-Value	Type
transmembrane domain	17	39	N/A	INTRINSIC
low complexity region	104	121	N/A	INTRINSIC
C2	315	418	3.29e-25	SMART
low complexity region	425	438	N/A	INTRINSIC
C2	446	560	4.98e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223586
AA Change: N190S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000224135
AA Change: N261S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225861

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have no gross abnormalities or obvious neurological defects. They do develop fibrosis in the skin and skeletal muscle over time. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Syt7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01956:Syt7	APN	19	10443391	missense	probably benign	0.03
R0412:Syt7	UTSW	19	10444080	nonsense	probably null
R1068:Syt7	UTSW	19	10444011	missense	probably benign	0.01
R1793:Syt7	UTSW	19	10443990	missense	probably damaging	1.00
R1955:Syt7	UTSW	19	10418038	missense	probably damaging	1.00
R2049:Syt7	UTSW	19	10439213	missense	probably benign	0.28
R2170:Syt7	UTSW	19	10439380	missense	probably damaging	1.00
R2911:Syt7	UTSW	19	10443435	missense	probably benign	0.00
R3694:Syt7	UTSW	19	10435636	missense	possibly damaging	0.69
R4330:Syt7	UTSW	19	10421798	missense	probably damaging	1.00
R4573:Syt7	UTSW	19	10439212	nonsense	probably null
R4691:Syt7	UTSW	19	10426481	missense	probably damaging	0.98
R4732:Syt7	UTSW	19	10442924	missense	probably damaging	1.00
R4733:Syt7	UTSW	19	10442924	missense	probably damaging	1.00
R4811:Syt7	UTSW	19	10435567	missense	probably damaging	0.98
R5067:Syt7	UTSW	19	10442858	missense	possibly damaging	0.58
R5071:Syt7	UTSW	19	10443428	missense	possibly damaging	0.92
R5372:Syt7	UTSW	19	10426621	missense	probably damaging	1.00
R5830:Syt7	UTSW	19	10421787	missense	probably damaging	1.00
R5979:Syt7	UTSW	19	10443479	missense	probably damaging	1.00
R6737:Syt7	UTSW	19	10444044	missense	probably damaging	1.00
R6833:Syt7	UTSW	19	10444144	missense	probably damaging	1.00
R6843:Syt7	UTSW	19	10421771	missense	probably damaging	1.00
R7010:Syt7	UTSW	19	10417990	missense	probably benign	0.16
R7078:Syt7	UTSW	19	10435599	missense	probably benign	0.14
R7206:Syt7	UTSW	19	10417973	missense	probably damaging	1.00
R9116:Syt7	UTSW	19	10444009	missense	probably damaging	1.00
R9451:Syt7	UTSW	19	10444168	missense	probably damaging	1.00
R9582:Syt7	UTSW	19	10439416	missense	probably damaging	1.00
R9610:Syt7	UTSW	19	10444095	missense	probably benign	0.06
Z1176:Syt7	UTSW	19	10443410	missense	probably damaging	1.00
Z1177:Syt7	UTSW	19	10426493	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GAATGTGATAGGACACCACCC -3'
(R):5'- CTCATTCCAGTGCGGGTTTAG -3'

Sequencing Primer
(F):5'- CTGGCCACATGTTGCAATAAG -3'
(R):5'- CCAGTGCGGGTTTAGATTCTTCC -3'

Posted On

2016-06-06