Incidental Mutation 'R5069:Syt7'
ID388593
Institutional Source Beutler Lab
Gene Symbol Syt7
Ensembl Gene ENSMUSG00000024743
Gene Namesynaptotagmin VII
Synonyms
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10389090-10453181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10439237 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 261 (N261S)
Ref Sequence ENSEMBL: ENSMUSP00000153132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073899] [ENSMUST00000076968] [ENSMUST00000169121] [ENSMUST00000223586] [ENSMUST00000224135]
Predicted Effect probably benign
Transcript: ENSMUST00000073899
AA Change: N146S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073560
Gene: ENSMUSG00000024743
AA Change: N146S

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 151 254 3.29e-25 SMART
low complexity region 261 274 N/A INTRINSIC
C2 282 396 4.98e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076968
AA Change: N354S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076234
Gene: ENSMUSG00000024743
AA Change: N354S

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 195 298 3.29e-25 SMART
low complexity region 305 318 N/A INTRINSIC
C2 326 440 4.98e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169121
AA Change: N310S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127973
Gene: ENSMUSG00000024743
AA Change: N310S

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
low complexity region 104 121 N/A INTRINSIC
C2 315 418 3.29e-25 SMART
low complexity region 425 438 N/A INTRINSIC
C2 446 560 4.98e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223586
AA Change: N190S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224135
AA Change: N261S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225861
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have no gross abnormalities or obvious neurological defects. They do develop fibrosis in the skin and skeletal muscle over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Syt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Syt7 APN 19 10443391 missense probably benign 0.03
R0412:Syt7 UTSW 19 10444080 nonsense probably null
R1068:Syt7 UTSW 19 10444011 missense probably benign 0.01
R1793:Syt7 UTSW 19 10443990 missense probably damaging 1.00
R1955:Syt7 UTSW 19 10418038 missense probably damaging 1.00
R2049:Syt7 UTSW 19 10439213 missense probably benign 0.28
R2170:Syt7 UTSW 19 10439380 missense probably damaging 1.00
R2911:Syt7 UTSW 19 10443435 missense probably benign 0.00
R3694:Syt7 UTSW 19 10435636 missense possibly damaging 0.69
R4330:Syt7 UTSW 19 10421798 missense probably damaging 1.00
R4573:Syt7 UTSW 19 10439212 nonsense probably null
R4691:Syt7 UTSW 19 10426481 missense probably damaging 0.98
R4732:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4733:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4811:Syt7 UTSW 19 10435567 missense probably damaging 0.98
R5067:Syt7 UTSW 19 10442858 missense possibly damaging 0.58
R5071:Syt7 UTSW 19 10443428 missense possibly damaging 0.92
R5372:Syt7 UTSW 19 10426621 missense probably damaging 1.00
R5830:Syt7 UTSW 19 10421787 missense probably damaging 1.00
R5979:Syt7 UTSW 19 10443479 missense probably damaging 1.00
R6737:Syt7 UTSW 19 10444044 missense probably damaging 1.00
R6833:Syt7 UTSW 19 10444144 missense probably damaging 1.00
R6843:Syt7 UTSW 19 10421771 missense probably damaging 1.00
R7010:Syt7 UTSW 19 10417990 missense probably benign 0.16
R7078:Syt7 UTSW 19 10435599 missense probably benign 0.14
R7206:Syt7 UTSW 19 10417973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGTGATAGGACACCACCC -3'
(R):5'- CTCATTCCAGTGCGGGTTTAG -3'

Sequencing Primer
(F):5'- CTGGCCACATGTTGCAATAAG -3'
(R):5'- CCAGTGCGGGTTTAGATTCTTCC -3'
Posted On2016-06-06