Incidental Mutation 'R5069:Pwwp4a'
ID 388598
Institutional Source Beutler Lab
Gene Symbol Pwwp4a
Ensembl Gene ENSMUSG00000067771
Gene Name PWWP domain containing 4A
Synonyms Gm14685
MMRRC Submission 042659-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R5069 (G1)
Quality Score 112
Status Not validated
Chromosome X
Chromosomal Location 72160653-72172868 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72171577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 323 (I323T)
Ref Sequence ENSEMBL: ENSMUSP00000137311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088459] [ENSMUST00000179117] [ENSMUST00000179600]
AlphaFold Q52KH6
Predicted Effect probably damaging
Transcript: ENSMUST00000088459
AA Change: I323T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085806
Gene: ENSMUSG00000067771
AA Change: I323T

DomainStartEndE-ValueType
PDB:3PMI|D 377 508 2e-35 PDB
low complexity region 675 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179117
AA Change: I323T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137311
Gene: ENSMUSG00000067771
AA Change: I323T

DomainStartEndE-ValueType
PDB:3PMI|D 377 508 2e-35 PDB
low complexity region 675 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179600
SMART Domains Protein: ENSMUSP00000137006
Gene: ENSMUSG00000058328

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Cor1 76 204 7.4e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,383,749 (GRCm39) S739P possibly damaging Het
AAdacl4fm3 T A 4: 144,430,437 (GRCm39) D184V probably damaging Het
Actn2 A G 13: 12,303,408 (GRCm39) I464T possibly damaging Het
Adcy7 T C 8: 89,054,325 (GRCm39) L1060P probably damaging Het
Aff3 A G 1: 38,220,694 (GRCm39) probably null Het
Ankar T C 1: 72,719,369 (GRCm39) probably null Het
Ankrd27 A T 7: 35,327,860 (GRCm39) K793N probably damaging Het
Arhgef28 T C 13: 98,211,714 (GRCm39) T90A probably damaging Het
Armc9 A T 1: 86,184,959 (GRCm39) H670L probably benign Het
Arvcf A G 16: 18,217,736 (GRCm39) Y412C probably damaging Het
Ass1 C T 2: 31,400,185 (GRCm39) T301M probably damaging Het
Baiap3 A T 17: 25,468,082 (GRCm39) C283S probably damaging Het
Birc6 C T 17: 74,872,967 (GRCm39) R409C probably damaging Het
Calcoco1 A G 15: 102,619,527 (GRCm39) L354P probably damaging Het
Cdh3 A G 8: 107,263,458 (GRCm39) N126S probably benign Het
Cfap54 A C 10: 92,773,636 (GRCm39) F135L probably benign Het
Dlg1 G T 16: 31,503,113 (GRCm39) probably null Het
Dnah3 T C 7: 119,632,013 (GRCm39) H1314R probably benign Het
Dsp A C 13: 38,381,099 (GRCm39) T2615P possibly damaging Het
Elapor2 T A 5: 9,490,897 (GRCm39) C636S probably damaging Het
Enpp2 T C 15: 54,727,450 (GRCm39) Y513C probably damaging Het
Ercc6 T C 14: 32,292,020 (GRCm39) V1128A probably benign Het
Firrm T C 1: 163,815,243 (GRCm39) T93A possibly damaging Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gm1043 T G 5: 37,344,580 (GRCm39) L231R probably damaging Het
Gpr153 T A 4: 152,364,340 (GRCm39) M132K probably damaging Het
Hbs1l T A 10: 21,230,546 (GRCm39) S496T probably damaging Het
Inpp5f A G 7: 128,278,451 (GRCm39) probably null Het
Kat6a G A 8: 23,393,149 (GRCm39) C209Y probably damaging Het
Kcna2 T A 3: 107,011,953 (GRCm39) V178D probably damaging Het
Krt75 A G 15: 101,474,673 (GRCm39) probably null Het
Letm2 G A 8: 26,083,980 (GRCm39) Q84* probably null Het
Mib1 A G 18: 10,793,002 (GRCm39) E646G probably damaging Het
Mmp14 T A 14: 54,676,570 (GRCm39) Y372N probably damaging Het
Muc6 A G 7: 141,237,564 (GRCm39) C218R probably damaging Het
Myof A T 19: 37,893,773 (GRCm39) I1130N possibly damaging Het
Neil3 A G 8: 54,054,076 (GRCm39) S318P possibly damaging Het
Nhlh1 A G 1: 171,881,467 (GRCm39) V133A probably benign Het
Nup153 A C 13: 46,863,268 (GRCm39) S331A probably benign Het
Nup98 T C 7: 101,794,862 (GRCm39) T882A probably benign Het
Or11g2 T A 14: 50,856,197 (GRCm39) C173S probably damaging Het
Or11h4 C A 14: 50,974,531 (GRCm39) L29F probably benign Het
Or52ab4 A T 7: 102,987,229 (GRCm39) probably null Het
Or9s23 T A 1: 92,501,135 (GRCm39) S81T probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pald1 A T 10: 61,177,025 (GRCm39) M675K possibly damaging Het
Pex5 A G 6: 124,390,555 (GRCm39) S97P probably benign Het
Pitpnm1 C T 19: 4,161,140 (GRCm39) A897V probably benign Het
Plxnd1 A T 6: 115,942,862 (GRCm39) V1274E probably damaging Het
Polr2a T C 11: 69,627,561 (GRCm39) probably null Het
Ppfia1 G A 7: 144,068,210 (GRCm39) Q446* probably null Het
Psma2 G A 13: 14,790,613 (GRCm39) V20I probably benign Het
Rhbdl2 T A 4: 123,711,710 (GRCm39) L149* probably null Het
Rnf17 T C 14: 56,743,385 (GRCm39) V1317A probably damaging Het
Rtel1 G A 2: 180,997,285 (GRCm39) V1042M probably benign Het
Sidt2 A T 9: 45,850,759 (GRCm39) probably null Het
Slc11a1 G A 1: 74,424,343 (GRCm39) A434T probably damaging Het
Slc28a2b A T 2: 122,324,854 (GRCm39) N142I possibly damaging Het
Slc4a10 G A 2: 62,097,915 (GRCm39) R508H probably benign Het
Slc5a8 A T 10: 88,722,460 (GRCm39) I98F possibly damaging Het
Slf2 T A 19: 44,923,692 (GRCm39) S169T possibly damaging Het
Snx33 A T 9: 56,833,475 (GRCm39) I198N probably damaging Het
Spock3 A G 8: 63,808,299 (GRCm39) T396A probably benign Het
Sva A T 6: 42,015,351 (GRCm39) probably benign Het
Syt7 A G 19: 10,416,601 (GRCm39) N261S probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Thoc2 C T X: 40,895,570 (GRCm39) E1491K probably damaging Het
Tlr1 T C 5: 65,083,743 (GRCm39) Y278C probably benign Het
Tph2 T A 10: 114,987,079 (GRCm39) Y237F probably benign Het
Trim35 C T 14: 66,546,421 (GRCm39) probably benign Het
Trpm4 T G 7: 44,959,893 (GRCm39) Y667S probably damaging Het
Ttc27 T A 17: 75,106,337 (GRCm39) H541Q probably damaging Het
Ube4a T C 9: 44,851,387 (GRCm39) H709R probably damaging Het
Vwa7 G A 17: 35,243,166 (GRCm39) V615I probably benign Het
Wars2 A G 3: 99,094,849 (GRCm39) H48R probably damaging Het
Xlr4c T A X: 72,282,290 (GRCm39) K121M probably damaging Het
Zfc3h1 T A 10: 115,254,688 (GRCm39) C1427* probably null Het
Other mutations in Pwwp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1162:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1178:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1416:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1422:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1498:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1520:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1544:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1674:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1774:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1888:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1888:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1984:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R1999:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R2025:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R2026:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R2054:Pwwp4a UTSW X 72,171,261 (GRCm39) missense probably damaging 0.97
R5068:Pwwp4a UTSW X 72,171,577 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGGCACATCTCTATCTCACC -3'
(R):5'- TTGAACCAGACCAGCGTTCC -3'

Sequencing Primer
(F):5'- GGCACATCTCTATCTCACCCAAAG -3'
(R):5'- TCCTCGCTCAATGGTGCTGG -3'
Posted On 2016-06-06