Mutagenetix > Incidental Mutation

Incidental Mutation 'R5070:Pou2f3'

388658

Institutional Source

Beutler Lab

Gene Symbol

Pou2f3

Ensembl Gene

ENSMUSG00000032015

Gene Name

POU domain, class 2, transcription factor 3

Synonyms

Otf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11

MMRRC Submission

042660-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5070 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43123939-43210369 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43145281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 93 (V93A)

Ref Sequence

ENSEMBL: ENSMUSP00000135115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034513
AA Change: V81A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: V81A

Domain	Start	End	E-Value	Type
low complexity region	107	122	N/A	INTRINSIC
low complexity region	150	162	N/A	INTRINSIC
POU	164	238	1.47e-53	SMART
low complexity region	239	256	N/A	INTRINSIC
HOX	262	324	8.39e-20	SMART
low complexity region	337	352	N/A	INTRINSIC
low complexity region	362	378	N/A	INTRINSIC
low complexity region	386	408	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176636
AA Change: V93A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: V93A

Domain	Start	End	E-Value	Type
low complexity region	119	134	N/A	INTRINSIC
low complexity region	162	174	N/A	INTRINSIC
POU	176	250	1.47e-53	SMART
low complexity region	251	268	N/A	INTRINSIC
HOX	274	336	8.39e-20	SMART
low complexity region	349	364	N/A	INTRINSIC
low complexity region	374	390	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213862

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	G	T	15: 84,420,163	A14E	possibly damaging	Het
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
Acacb	T	C	5: 114,246,028	I2206T	possibly damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
AI987944	C	T	7: 41,375,324	G77D	probably benign	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
Bend3	A	T	10: 43,493,685	E11D	probably damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Cds2	T	A	2: 132,302,088	Y4*	probably null	Het
Celsr1	G	T	15: 85,939,134	P1691Q	possibly damaging	Het
Chmp1a	A	T	8: 123,206,315	V133E	probably benign	Het
Cnbd2	T	C	2: 156,335,398	V92A	probably damaging	Het
Comp	G	A	8: 70,376,495	G272S	probably benign	Het
Csnk1a1	T	A	18: 61,555,781	F11I	probably benign	Het
Ctse	A	G	1: 131,668,179	D203G	probably damaging	Het
Cyp1b1	T	A	17: 79,710,611	M372L	probably benign	Het
Cyp2c66	T	A	19: 39,163,470	S210T	probably benign	Het
Dnah1	G	A	14: 31,282,418	P2385S	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Eif4g3	A	G	4: 138,146,299	T682A	probably benign	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Fam136b-ps	C	T	15: 31,276,716		probably benign	Het
Fbxl7	T	A	15: 26,789,554	H29L	probably benign	Het
Fbxw22	A	G	9: 109,385,115	V211A	probably benign	Het
Frk	A	T	10: 34,484,284	K94*	probably null	Het
G0s2	T	A	1: 193,272,562	E71D	probably damaging	Het
Gfpt1	A	G	6: 87,053,745		probably null	Het
Gga1	A	G	15: 78,892,017	D420G	possibly damaging	Het
Gldc	T	C	19: 30,118,598	Q671R	possibly damaging	Het
Gpc6	A	G	14: 117,186,769	T90A	probably benign	Het
Gucy2g	C	A	19: 55,229,787	V410F	probably damaging	Het
Ifnlr1	T	C	4: 135,704,198	S233P	probably benign	Het
Ighv1-9	A	T	12: 114,583,757	W55R	probably damaging	Het
Igsf10	T	A	3: 59,328,293	H1489L	probably benign	Het
Il17re	T	C	6: 113,459,010	L39P	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Kcnk3	A	G	5: 30,622,386	H260R	possibly damaging	Het
Kctd19	T	C	8: 105,391,999	Y287C	probably damaging	Het
Klhl28	A	T	12: 64,957,712	M9K	probably benign	Het
Lama2	A	G	10: 27,350,251		probably null	Het
Lrrc27	A	T	7: 139,214,799	D26V	probably damaging	Het
Mcm4	A	G	16: 15,625,570	S830P	probably damaging	Het
Mei1	T	A	15: 82,077,603	C188S	possibly damaging	Het
Mettl13	C	T	1: 162,545,899	R261H	possibly damaging	Het
Mex3a	A	T	3: 88,536,387	I257F	probably damaging	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mier2	T	C	10: 79,549,577	D139G	probably benign	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Mrvi1	A	G	7: 110,925,312	S208P	probably benign	Het
Myh14	A	G	7: 44,616,248	V1569A	possibly damaging	Het
Myo18b	T	C	5: 112,761,346	E1977G	probably damaging	Het
Myo3b	T	C	2: 70,253,112	L675P	probably damaging	Het
N4bp1	A	G	8: 86,860,537	V591A	probably damaging	Het
Nedd9	C	A	13: 41,316,598	V360L	probably benign	Het
Oit3	C	T	10: 59,424,027	R518H	probably damaging	Het
Olfr1122	T	G	2: 87,388,163	C153G	probably damaging	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr171	A	G	16: 19,624,992	I36T	possibly damaging	Het
Olfr342	T	A	2: 36,527,766	M118K	probably damaging	Het
Olfr531	A	G	7: 140,400,569	V159A	probably benign	Het
Olfr744	A	G	14: 50,618,474	N84S	probably benign	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pask	A	T	1: 93,330,874	C251S	probably damaging	Het
Pdzk1	A	T	3: 96,850,321	D31V	probably benign	Het
Pmfbp1	A	T	8: 109,530,155	Q497L	probably damaging	Het
Pofut1	T	C	2: 153,261,566		probably benign	Het
Polr2h	A	G	16: 20,721,966	N95S	probably damaging	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Prkd1	A	T	12: 50,394,622	L327*	probably null	Het
Prrt4	T	C	6: 29,177,512	E86G	probably benign	Het
Psen2	T	C	1: 180,228,857	I393V	probably benign	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Qser1	C	T	2: 104,787,282	V1062I	possibly damaging	Het
Rab11b	G	T	17: 33,748,881	A114D	probably damaging	Het
Rag1	A	T	2: 101,642,311	W829R	probably damaging	Het
Rgl3	A	G	9: 21,988,044		probably null	Het
Rgs8	C	T	1: 153,665,904	T3I	probably damaging	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rps6kb2	A	T	19: 4,163,228	D6E	probably damaging	Het
Skint5	T	A	4: 113,795,538	I630F	unknown	Het
Skint7	T	C	4: 111,984,134	L257P	probably damaging	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Sorl1	T	C	9: 42,031,818	K921E	possibly damaging	Het
Stub1	A	G	17: 25,832,138	L90P	probably damaging	Het
Sycp1	A	T	3: 102,920,565	S289T	probably damaging	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tead3	T	C	17: 28,341,477	K51R	probably benign	Het
Tmed11	T	A	5: 108,795,223	I30L	probably benign	Het
Tmem131	A	G	1: 36,854,905	I139T	probably damaging	Het
Tmem191c	A	G	16: 17,277,695	Q206R	probably null	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Tsc22d1	T	C	14: 76,418,310	I661T	probably benign	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Uqcrq	A	G	11: 53,430,127		probably null	Het
Vmn1r215	T	A	13: 23,076,496	S235R	probably benign	Het
Vmn1r70	T	C	7: 10,634,398	V271A	probably benign	Het
Vps13a	G	A	19: 16,654,484	R2596C	probably benign	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wdr90	T	C	17: 25,846,333	T1650A	probably damaging	Het
Zbtb32	T	A	7: 30,591,466	M135L	probably benign	Het
Zc2hc1c	A	G	12: 85,290,514	D315G	probably benign	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het
Zfp30	A	G	7: 29,786,266		probably benign	Het
Zfp428	T	A	7: 24,515,125	D55E	probably damaging	Het
Zfyve26	A	T	12: 79,255,361	N1820K	probably damaging	Het
Zw10	C	A	9: 49,077,459	S675*	probably null	Het

Other mutations in Pou2f3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pou2f3	APN	9	43128893	missense	probably damaging	1.00
IGL00508:Pou2f3	APN	9	43139963	missense	probably benign	0.01
IGL00975:Pou2f3	APN	9	43137384	missense	probably benign
IGL01577:Pou2f3	APN	9	43146881	nonsense	probably null
IGL01871:Pou2f3	APN	9	43134473	splice site	probably benign
IGL02370:Pou2f3	APN	9	43137348	missense	probably damaging	1.00
IGL02674:Pou2f3	APN	9	43139333	missense	probably damaging	1.00
IGL02746:Pou2f3	APN	9	43146846	missense	probably benign	0.01
IGL02956:Pou2f3	APN	9	43142805	splice site	probably benign
IGL02962:Pou2f3	APN	9	43125089	utr 3 prime	probably benign
IGL03082:Pou2f3	APN	9	43146915	critical splice acceptor site	probably null
R0433:Pou2f3	UTSW	9	43127398	missense	probably benign	0.23
R0622:Pou2f3	UTSW	9	43125119	missense	probably damaging	1.00
R0926:Pou2f3	UTSW	9	43146901	missense	probably damaging	1.00
R1956:Pou2f3	UTSW	9	43145237	missense	probably benign
R4782:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R4877:Pou2f3	UTSW	9	43139323	missense	possibly damaging	0.58
R5910:Pou2f3	UTSW	9	43134474	splice site	probably null
R6280:Pou2f3	UTSW	9	43139339	missense	probably damaging	1.00
R6280:Pou2f3	UTSW	9	43139340	missense	probably damaging	1.00
R6465:Pou2f3	UTSW	9	43139867	missense	probably damaging	1.00
R7084:Pou2f3	UTSW	9	43128893	missense	probably damaging	1.00
R7161:Pou2f3	UTSW	9	43139363	missense	probably damaging	1.00
R8036:Pou2f3	UTSW	9	43146908	missense	probably damaging	1.00
R8406:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R8912:Pou2f3	UTSW	9	43199039	missense	probably benign	0.00
R9224:Pou2f3	UTSW	9	43139399	missense	probably damaging	1.00
R9329:Pou2f3	UTSW	9	43128929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAGTTTTCATACCAGAGGAGTG -3'
(R):5'- TAGCATACTCAAGTGACAGGATAG -3'

Sequencing Primer
(F):5'- AGTGAGTAGTATCTGTGACACCC -3'
(R):5'- TGGATGGTCGAAAACACCC -3'

Posted On

2016-06-06