Mutagenetix > Incidental Mutation

Incidental Mutation 'R5070:Dsp'

388682

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

042660-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5070 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 38197123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 2615 (T2615P)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124830
AA Change: T2615P

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: T2615P

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127906
AA Change: T2016P

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: T2016P

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	G	T	15: 84,420,163	A14E	possibly damaging	Het
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
Acacb	T	C	5: 114,246,028	I2206T	possibly damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
AI987944	C	T	7: 41,375,324	G77D	probably benign	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
Bend3	A	T	10: 43,493,685	E11D	probably damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Cds2	T	A	2: 132,302,088	Y4*	probably null	Het
Celsr1	G	T	15: 85,939,134	P1691Q	possibly damaging	Het
Chmp1a	A	T	8: 123,206,315	V133E	probably benign	Het
Cnbd2	T	C	2: 156,335,398	V92A	probably damaging	Het
Comp	G	A	8: 70,376,495	G272S	probably benign	Het
Csnk1a1	T	A	18: 61,555,781	F11I	probably benign	Het
Ctse	A	G	1: 131,668,179	D203G	probably damaging	Het
Cyp1b1	T	A	17: 79,710,611	M372L	probably benign	Het
Cyp2c66	T	A	19: 39,163,470	S210T	probably benign	Het
Dnah1	G	A	14: 31,282,418	P2385S	probably benign	Het
Eif4g3	A	G	4: 138,146,299	T682A	probably benign	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Fam136b-ps	C	T	15: 31,276,716		probably benign	Het
Fbxl7	T	A	15: 26,789,554	H29L	probably benign	Het
Fbxw22	A	G	9: 109,385,115	V211A	probably benign	Het
Frk	A	T	10: 34,484,284	K94*	probably null	Het
G0s2	T	A	1: 193,272,562	E71D	probably damaging	Het
Gfpt1	A	G	6: 87,053,745		probably null	Het
Gga1	A	G	15: 78,892,017	D420G	possibly damaging	Het
Gldc	T	C	19: 30,118,598	Q671R	possibly damaging	Het
Gpc6	A	G	14: 117,186,769	T90A	probably benign	Het
Gucy2g	C	A	19: 55,229,787	V410F	probably damaging	Het
Ifnlr1	T	C	4: 135,704,198	S233P	probably benign	Het
Ighv1-9	A	T	12: 114,583,757	W55R	probably damaging	Het
Igsf10	T	A	3: 59,328,293	H1489L	probably benign	Het
Il17re	T	C	6: 113,459,010	L39P	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Kcnk3	A	G	5: 30,622,386	H260R	possibly damaging	Het
Kctd19	T	C	8: 105,391,999	Y287C	probably damaging	Het
Klhl28	A	T	12: 64,957,712	M9K	probably benign	Het
Lama2	A	G	10: 27,350,251		probably null	Het
Lrrc27	A	T	7: 139,214,799	D26V	probably damaging	Het
Mcm4	A	G	16: 15,625,570	S830P	probably damaging	Het
Mei1	T	A	15: 82,077,603	C188S	possibly damaging	Het
Mettl13	C	T	1: 162,545,899	R261H	possibly damaging	Het
Mex3a	A	T	3: 88,536,387	I257F	probably damaging	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mier2	T	C	10: 79,549,577	D139G	probably benign	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Mrvi1	A	G	7: 110,925,312	S208P	probably benign	Het
Myh14	A	G	7: 44,616,248	V1569A	possibly damaging	Het
Myo18b	T	C	5: 112,761,346	E1977G	probably damaging	Het
Myo3b	T	C	2: 70,253,112	L675P	probably damaging	Het
N4bp1	A	G	8: 86,860,537	V591A	probably damaging	Het
Nedd9	C	A	13: 41,316,598	V360L	probably benign	Het
Oit3	C	T	10: 59,424,027	R518H	probably damaging	Het
Olfr1122	T	G	2: 87,388,163	C153G	probably damaging	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr171	A	G	16: 19,624,992	I36T	possibly damaging	Het
Olfr342	T	A	2: 36,527,766	M118K	probably damaging	Het
Olfr531	A	G	7: 140,400,569	V159A	probably benign	Het
Olfr744	A	G	14: 50,618,474	N84S	probably benign	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pask	A	T	1: 93,330,874	C251S	probably damaging	Het
Pdzk1	A	T	3: 96,850,321	D31V	probably benign	Het
Pmfbp1	A	T	8: 109,530,155	Q497L	probably damaging	Het
Pofut1	T	C	2: 153,261,566		probably benign	Het
Polr2h	A	G	16: 20,721,966	N95S	probably damaging	Het
Pou2f3	A	G	9: 43,145,281	V93A	possibly damaging	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Prkd1	A	T	12: 50,394,622	L327*	probably null	Het
Prrt4	T	C	6: 29,177,512	E86G	probably benign	Het
Psen2	T	C	1: 180,228,857	I393V	probably benign	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Qser1	C	T	2: 104,787,282	V1062I	possibly damaging	Het
Rab11b	G	T	17: 33,748,881	A114D	probably damaging	Het
Rag1	A	T	2: 101,642,311	W829R	probably damaging	Het
Rgl3	A	G	9: 21,988,044		probably null	Het
Rgs8	C	T	1: 153,665,904	T3I	probably damaging	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rps6kb2	A	T	19: 4,163,228	D6E	probably damaging	Het
Skint5	T	A	4: 113,795,538	I630F	unknown	Het
Skint7	T	C	4: 111,984,134	L257P	probably damaging	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Sorl1	T	C	9: 42,031,818	K921E	possibly damaging	Het
Stub1	A	G	17: 25,832,138	L90P	probably damaging	Het
Sycp1	A	T	3: 102,920,565	S289T	probably damaging	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tead3	T	C	17: 28,341,477	K51R	probably benign	Het
Tmed11	T	A	5: 108,795,223	I30L	probably benign	Het
Tmem131	A	G	1: 36,854,905	I139T	probably damaging	Het
Tmem191c	A	G	16: 17,277,695	Q206R	probably null	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Tsc22d1	T	C	14: 76,418,310	I661T	probably benign	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Uqcrq	A	G	11: 53,430,127		probably null	Het
Vmn1r215	T	A	13: 23,076,496	S235R	probably benign	Het
Vmn1r70	T	C	7: 10,634,398	V271A	probably benign	Het
Vps13a	G	A	19: 16,654,484	R2596C	probably benign	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wdr90	T	C	17: 25,846,333	T1650A	probably damaging	Het
Zbtb32	T	A	7: 30,591,466	M135L	probably benign	Het
Zc2hc1c	A	G	12: 85,290,514	D315G	probably benign	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het
Zfp30	A	G	7: 29,786,266		probably benign	Het
Zfp428	T	A	7: 24,515,125	D55E	probably damaging	Het
Zfyve26	A	T	12: 79,255,361	N1820K	probably damaging	Het
Zw10	C	A	9: 49,077,459	S675*	probably null	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CGATCAATACCGATCAGGCAG -3'
(R):5'- CTGGTTGACTGCATCTTGAAGG -3'

Sequencing Primer
(F):5'- TACCGATCAGGCAGCCTTAG -3'
(R):5'- CATCTTGAAGGGAGAGCTTCTGACC -3'

Posted On

2016-06-06