Incidental Mutation 'R5070:Celsr1'
ID388703
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Namecadherin, EGF LAG seven-pass G-type receptor 1
Synonymscrash, Crsh, Scy
MMRRC Submission 042660-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R5070 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85898929-86033777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85939134 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1691 (P1691Q)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016172
AA Change: P1691Q

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: P1691Q

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226840
AA Change: P324Q
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik G T 15: 84,420,163 A14E possibly damaging Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
Acacb T C 5: 114,246,028 I2206T possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
AI987944 C T 7: 41,375,324 G77D probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
Bend3 A T 10: 43,493,685 E11D probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Cds2 T A 2: 132,302,088 Y4* probably null Het
Chmp1a A T 8: 123,206,315 V133E probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Comp G A 8: 70,376,495 G272S probably benign Het
Csnk1a1 T A 18: 61,555,781 F11I probably benign Het
Ctse A G 1: 131,668,179 D203G probably damaging Het
Cyp1b1 T A 17: 79,710,611 M372L probably benign Het
Cyp2c66 T A 19: 39,163,470 S210T probably benign Het
Dnah1 G A 14: 31,282,418 P2385S probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Eif4g3 A G 4: 138,146,299 T682A probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fam136b-ps C T 15: 31,276,716 probably benign Het
Fbxl7 T A 15: 26,789,554 H29L probably benign Het
Fbxw22 A G 9: 109,385,115 V211A probably benign Het
Frk A T 10: 34,484,284 K94* probably null Het
G0s2 T A 1: 193,272,562 E71D probably damaging Het
Gfpt1 A G 6: 87,053,745 probably null Het
Gga1 A G 15: 78,892,017 D420G possibly damaging Het
Gldc T C 19: 30,118,598 Q671R possibly damaging Het
Gpc6 A G 14: 117,186,769 T90A probably benign Het
Gucy2g C A 19: 55,229,787 V410F probably damaging Het
Ifnlr1 T C 4: 135,704,198 S233P probably benign Het
Ighv1-9 A T 12: 114,583,757 W55R probably damaging Het
Igsf10 T A 3: 59,328,293 H1489L probably benign Het
Il17re T C 6: 113,459,010 L39P probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Kcnk3 A G 5: 30,622,386 H260R possibly damaging Het
Kctd19 T C 8: 105,391,999 Y287C probably damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Lama2 A G 10: 27,350,251 probably null Het
Lrrc27 A T 7: 139,214,799 D26V probably damaging Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Mei1 T A 15: 82,077,603 C188S possibly damaging Het
Mettl13 C T 1: 162,545,899 R261H possibly damaging Het
Mex3a A T 3: 88,536,387 I257F probably damaging Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mier2 T C 10: 79,549,577 D139G probably benign Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrvi1 A G 7: 110,925,312 S208P probably benign Het
Myh14 A G 7: 44,616,248 V1569A possibly damaging Het
Myo18b T C 5: 112,761,346 E1977G probably damaging Het
Myo3b T C 2: 70,253,112 L675P probably damaging Het
N4bp1 A G 8: 86,860,537 V591A probably damaging Het
Nedd9 C A 13: 41,316,598 V360L probably benign Het
Oit3 C T 10: 59,424,027 R518H probably damaging Het
Olfr1122 T G 2: 87,388,163 C153G probably damaging Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr171 A G 16: 19,624,992 I36T possibly damaging Het
Olfr342 T A 2: 36,527,766 M118K probably damaging Het
Olfr531 A G 7: 140,400,569 V159A probably benign Het
Olfr744 A G 14: 50,618,474 N84S probably benign Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pask A T 1: 93,330,874 C251S probably damaging Het
Pdzk1 A T 3: 96,850,321 D31V probably benign Het
Pmfbp1 A T 8: 109,530,155 Q497L probably damaging Het
Pofut1 T C 2: 153,261,566 probably benign Het
Polr2h A G 16: 20,721,966 N95S probably damaging Het
Pou2f3 A G 9: 43,145,281 V93A possibly damaging Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Prkd1 A T 12: 50,394,622 L327* probably null Het
Prrt4 T C 6: 29,177,512 E86G probably benign Het
Psen2 T C 1: 180,228,857 I393V probably benign Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Qser1 C T 2: 104,787,282 V1062I possibly damaging Het
Rab11b G T 17: 33,748,881 A114D probably damaging Het
Rag1 A T 2: 101,642,311 W829R probably damaging Het
Rgl3 A G 9: 21,988,044 probably null Het
Rgs8 C T 1: 153,665,904 T3I probably damaging Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rps6kb2 A T 19: 4,163,228 D6E probably damaging Het
Skint5 T A 4: 113,795,538 I630F unknown Het
Skint7 T C 4: 111,984,134 L257P probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Sorl1 T C 9: 42,031,818 K921E possibly damaging Het
Stub1 A G 17: 25,832,138 L90P probably damaging Het
Sycp1 A T 3: 102,920,565 S289T probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tead3 T C 17: 28,341,477 K51R probably benign Het
Tmed11 T A 5: 108,795,223 I30L probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tmem191c A G 16: 17,277,695 Q206R probably null Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uqcrq A G 11: 53,430,127 probably null Het
Vmn1r215 T A 13: 23,076,496 S235R probably benign Het
Vmn1r70 T C 7: 10,634,398 V271A probably benign Het
Vps13a G A 19: 16,654,484 R2596C probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdr90 T C 17: 25,846,333 T1650A probably damaging Het
Zbtb32 T A 7: 30,591,466 M135L probably benign Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp30 A G 7: 29,786,266 probably benign Het
Zfp428 T A 7: 24,515,125 D55E probably damaging Het
Zfyve26 A T 12: 79,255,361 N1820K probably damaging Het
Zw10 C A 9: 49,077,459 S675* probably null Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85931345 missense probably benign 0.04
IGL00519:Celsr1 APN 15 86030836 missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85922235 missense probably damaging 1.00
IGL01303:Celsr1 APN 15 86030491 missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85926190 missense probably benign 0.35
IGL01910:Celsr1 APN 15 85929895 missense probably benign
IGL01931:Celsr1 APN 15 85907660 missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85963223 missense probably benign 0.35
IGL02090:Celsr1 APN 15 85907721 missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85979004 missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85929907 missense probably benign 0.01
IGL02413:Celsr1 APN 15 86031226 missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85941136 missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85900688 utr 3 prime probably benign
IGL02508:Celsr1 APN 15 86030617 nonsense probably null
IGL02899:Celsr1 APN 15 86031726 missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85901472 missense probably benign
IGL03212:Celsr1 APN 15 85930677 missense probably benign 0.04
P0028:Celsr1 UTSW 15 85922235 missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85900937 missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 86032414 missense probably damaging 0.99
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85929419 missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 86030762 missense probably benign 0.02
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85902864 missense probably benign 0.00
R0570:Celsr1 UTSW 15 85903365 missense probably benign 0.18
R0611:Celsr1 UTSW 15 85932323 missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85901597 missense probably benign
R0792:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R0943:Celsr1 UTSW 15 85903288 missense probably damaging 1.00
R0989:Celsr1 UTSW 15 86031279 missense probably benign 0.39
R1118:Celsr1 UTSW 15 86032047 missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R1239:Celsr1 UTSW 15 85979146 missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1522:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R1662:Celsr1 UTSW 15 86031062 missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85932457 missense probably benign 0.00
R1795:Celsr1 UTSW 15 86030323 missense probably damaging 0.99
R1799:Celsr1 UTSW 15 86032685 missense probably damaging 1.00
R1858:Celsr1 UTSW 15 86032759 missense probably damaging 1.00
R2040:Celsr1 UTSW 15 86032887 missense probably damaging 1.00
R2050:Celsr1 UTSW 15 86030547 missense probably benign 0.02
R2131:Celsr1 UTSW 15 85963223 missense probably benign 0.35
R2132:Celsr1 UTSW 15 86031967 missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85979230 missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85916723 missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 86031807 missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85978827 missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85963133 missense probably benign 0.00
R4414:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4416:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85916756 missense probably benign 0.35
R4666:Celsr1 UTSW 15 86030494 missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85932460 missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85906029 critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85937953 missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85937911 missense probably damaging 0.99
R5218:Celsr1 UTSW 15 85932384 missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85930546 missense probably benign
R5310:Celsr1 UTSW 15 85926222 missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85931282 missense probably benign 0.00
R5639:Celsr1 UTSW 15 86030767 missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85941264 missense probably benign 0.27
R5778:Celsr1 UTSW 15 86032955 missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85904014 missense probably benign 0.02
R5915:Celsr1 UTSW 15 85937975 missense probably benign
R5915:Celsr1 UTSW 15 86030349 missense probably damaging 0.96
R5932:Celsr1 UTSW 15 86032704 missense probably damaging 1.00
R5950:Celsr1 UTSW 15 86032500 missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85919038 splice site probably null
R6050:Celsr1 UTSW 15 85930611 missense probably benign 0.00
R6117:Celsr1 UTSW 15 85932411 missense probably benign 0.04
R6178:Celsr1 UTSW 15 85901021 missense probably benign 0.08
R6186:Celsr1 UTSW 15 85921193 missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85916687 missense probably benign 0.25
R6307:Celsr1 UTSW 15 85928330 missense probably benign
R6320:Celsr1 UTSW 15 85900959 missense probably benign 0.13
R6349:Celsr1 UTSW 15 86031684 missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85978920 missense probably benign 0.07
R6607:Celsr1 UTSW 15 85963285 missense probably benign
R6615:Celsr1 UTSW 15 85902114 critical splice donor site probably null
R6661:Celsr1 UTSW 15 85918934 missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85905914 critical splice donor site probably null
R6743:Celsr1 UTSW 15 85907598 missense probably damaging 0.96
R6746:Celsr1 UTSW 15 86031495 missense probably damaging 1.00
R6772:Celsr1 UTSW 15 86030782 missense probably benign
R6838:Celsr1 UTSW 15 85939194 missense probably benign
R6886:Celsr1 UTSW 15 86031654 missense probably benign 0.00
R7030:Celsr1 UTSW 15 85905478 missense probably damaging 0.99
R7060:Celsr1 UTSW 15 86032655 missense probably benign 0.07
R7080:Celsr1 UTSW 15 85932451 missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 86033008 missense probably damaging 0.99
R7357:Celsr1 UTSW 15 86030514 missense probably benign 0.00
R7371:Celsr1 UTSW 15 86030674 missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85907673 missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 86033392 missense probably benign
R7491:Celsr1 UTSW 15 86032518 missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85929872 missense probably benign 0.00
R7685:Celsr1 UTSW 15 85978732 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAACTCCACAGGGCTCAG -3'
(R):5'- CATGCATGGGTCAGTATGGG -3'

Sequencing Primer
(F):5'- GTGTGTCCACAGCCACCTTG -3'
(R):5'- GGGATGGTGAAGGTCCTTAAG -3'
Posted On2016-06-06