Incidental Mutation 'R5071:Atp8a1'
ID388757
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission 042661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5071 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67815723 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 27 (K27N)
Ref Sequence ENSEMBL: ENSMUSP00000121630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000113651] [ENSMUST00000113652] [ENSMUST00000135930] [ENSMUST00000141443] [ENSMUST00000200955]
Predicted Effect probably benign
Transcript: ENSMUST00000037380
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072971
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113651
SMART Domains Protein: ENSMUSP00000109281
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Blast:CUB 46 87 4e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113652
SMART Domains Protein: ENSMUSP00000109282
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Blast:CUB 46 87 9e-6 BLAST
Pfam:E1-E2_ATPase 104 175 6.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130652
Predicted Effect probably benign
Transcript: ENSMUST00000135930
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141443
AA Change: K27N

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121630
Gene: ENSMUSG00000037685
AA Change: K27N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 51 106 9.6e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143013
Predicted Effect probably benign
Transcript: ENSMUST00000200955
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI182371 A T 2: 35,085,215 I334N probably benign Het
Aldh1b1 A G 4: 45,803,383 probably null Het
Armc9 G A 1: 86,186,116 M298I probably benign Het
BC004004 G A 17: 29,294,415 probably null Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh17 G T 4: 11,810,325 G672V probably damaging Het
Cdh5 C A 8: 104,140,702 T537K probably damaging Het
Chd1 T A 17: 15,762,405 S1377R probably benign Het
Chd2 T C 7: 73,429,689 N1821S probably benign Het
Cnot3 A G 7: 3,650,861 K4R probably damaging Het
Colq T A 14: 31,528,832 I339F possibly damaging Het
Coq2 A T 5: 100,667,950 L121Q probably damaging Het
Csnk1e G A 15: 79,420,872 R342* probably null Het
Cstl1 A T 2: 148,750,927 M1L probably benign Het
Cwh43 A G 5: 73,423,913 probably null Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dgkh T C 14: 78,604,532 K417E probably damaging Het
Dnah11 A T 12: 118,082,453 L1750* probably null Het
Edn1 A G 13: 42,303,677 E62G probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Fitm1 T A 14: 55,575,773 V31E possibly damaging Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gabrd A C 4: 155,387,162 F228C probably damaging Het
Gm5916 A C 9: 36,128,668 L8R probably benign Het
Gm9573 G A 17: 35,620,552 probably benign Het
Gpr108 A G 17: 57,235,335 S557P probably damaging Het
Gpr75 C A 11: 30,892,380 N428K probably damaging Het
H2-M5 T G 17: 36,987,184 probably null Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Homer3 T C 8: 70,291,355 V243A probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi203 T C 1: 173,935,110 Q152R possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ighv1-24 A G 12: 114,773,128 Y51H probably benign Het
Inf2 A T 12: 112,612,039 probably null Het
Insl6 T C 19: 29,325,255 R21G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Ltbp3 T C 19: 5,756,823 C1043R probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mpeg1 T A 19: 12,461,181 M1K probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nek9 C A 12: 85,327,459 R268L possibly damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1186 T C 2: 88,526,041 S153P probably damaging Het
Olfr167 A G 16: 19,515,027 I203T probably benign Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr986 T C 9: 40,187,664 L183S probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Plagl1 A G 10: 13,127,261 Y91C probably damaging Het
Polr1a A G 6: 71,931,709 N506S possibly damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Ptprf C A 4: 118,211,999 G1624W probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Rc3h1 A G 1: 160,959,477 D814G possibly damaging Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Rusc2 A G 4: 43,415,240 D182G probably benign Het
Setd1b A G 5: 123,160,914 probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Smarcc2 A G 10: 128,463,940 D158G probably damaging Het
Sptbn1 A G 11: 30,113,854 probably null Het
St3gal5 T C 6: 72,132,053 C42R probably damaging Het
Syt7 T C 19: 10,443,428 S397P possibly damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Thada T A 17: 84,386,532 D1263V probably damaging Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tpcn1 A T 5: 120,548,269 probably null Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Ubxn2b A T 4: 6,214,746 Q260L probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp5 A G 6: 124,826,379 F7L probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn1r28 A T 6: 58,265,909 I246F probably benign Het
Vmn2r2 C A 3: 64,116,900 M753I probably benign Het
Zbtb26 T C 2: 37,435,929 H365R probably benign Het
Zfp976 A T 7: 42,612,930 Y494* probably null Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7594:Atp8a1 UTSW 5 67651592 missense
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
R8152:Atp8a1 UTSW 5 67762582 missense
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATCTGGGAAGTCCATTTGTTTCC -3'
(R):5'- TGTCACTAGCGGCTGGTTATC -3'

Sequencing Primer
(F):5'- GGGAAGTCCATTTGTTTCCTTTCC -3'
(R):5'- CACTAGCGGCTGGTTATCATTAG -3'
Posted On2016-06-06