Mutagenetix > Incidental Mutation

Incidental Mutation 'R5071:Tenm2'

388798

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

042661-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.584) question?

Stock #

R5071 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 36068381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1114 (T1114S)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057207
AA Change: T1114S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: T1114S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102801
AA Change: T1113S

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: T1113S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163524
AA Change: T1113S

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: T1113S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Meta Mutation Damage Score

0.0892

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	A	T	15: 64,787,358	W528R	probably damaging	Het
Agbl1	A	G	7: 76,421,917	E329G	probably damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
AI182371	A	T	2: 35,085,215	I334N	probably benign	Het
Aldh1b1	A	G	4: 45,803,383		probably null	Het
Armc9	G	A	1: 86,186,116	M298I	probably benign	Het
Atp8a1	T	A	5: 67,815,723	K27N	probably benign	Het
BC004004	G	A	17: 29,294,415		probably null	Het
Ccdc83	A	T	7: 90,250,529	F45Y	probably damaging	Het
Cct8l1	G	A	5: 25,516,883	V199I	probably benign	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cdh17	G	T	4: 11,810,325	G672V	probably damaging	Het
Cdh5	C	A	8: 104,140,702	T537K	probably damaging	Het
Chd1	T	A	17: 15,762,405	S1377R	probably benign	Het
Chd2	T	C	7: 73,429,689	N1821S	probably benign	Het
Cnot3	A	G	7: 3,650,861	K4R	probably damaging	Het
Colq	T	A	14: 31,528,832	I339F	possibly damaging	Het
Coq2	A	T	5: 100,667,950	L121Q	probably damaging	Het
Csnk1e	G	A	15: 79,420,872	R342*	probably null	Het
Cstl1	A	T	2: 148,750,927	M1L	probably benign	Het
Cwh43	A	G	5: 73,423,913		probably null	Het
Cyp2a22	A	T	7: 26,932,481	F450Y	probably benign	Het
Cyp2d10	C	T	15: 82,403,753	R383H	probably benign	Het
Cyp4a29	A	G	4: 115,247,663	T123A	probably benign	Het
Dgkh	T	C	14: 78,604,532	K417E	probably damaging	Het
Dnah11	A	T	12: 118,082,453	L1750*	probably null	Het
Edn1	A	G	13: 42,303,677	E62G	probably damaging	Het
Eef1akmt1	A	G	14: 57,566,007	L30P	probably damaging	Het
Fbxo42	T	C	4: 141,198,945	W313R	probably damaging	Het
Fign	A	T	2: 63,979,693	L411*	probably null	Het
Fitm1	T	A	14: 55,575,773	V31E	possibly damaging	Het
Fryl	G	A	5: 73,074,767	P1550L	probably damaging	Het
Gabrd	A	C	4: 155,387,162	F228C	probably damaging	Het
Gm5916	A	C	9: 36,128,668	L8R	probably benign	Het
Gm9573	G	A	17: 35,620,552		probably benign	Het
Gpr108	A	G	17: 57,235,335	S557P	probably damaging	Het
Gpr75	C	A	11: 30,892,380	N428K	probably damaging	Het
H2-M5	T	G	17: 36,987,184		probably null	Het
Hdac6	A	G	X: 7,944,797	F104L	probably damaging	Homo
Homer3	T	C	8: 70,291,355	V243A	probably benign	Het
Hspg2	T	C	4: 137,540,230	S2050P	probably damaging	Het
Hydin	A	G	8: 110,538,473	N2763D	probably benign	Het
Ifi203	T	C	1: 173,935,110	Q152R	possibly damaging	Het
Ifi44	T	C	3: 151,749,632		probably benign	Het
Ifi47	A	G	11: 49,095,534	T43A	probably benign	Het
Ighv1-24	A	G	12: 114,773,128	Y51H	probably benign	Het
Inf2	A	T	12: 112,612,039		probably null	Het
Insl6	T	C	19: 29,325,255	R21G	probably benign	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Ltbp3	T	C	19: 5,756,823	C1043R	probably damaging	Het
Mkl1	A	G	15: 81,022,426	V91A	probably damaging	Het
Mpeg1	T	A	19: 12,461,181	M1K	probably null	Het
Ncald	A	T	15: 37,397,234	H67Q	probably damaging	Het
Nek9	C	A	12: 85,327,459	R268L	possibly damaging	Het
Nudt5	T	A	2: 5,864,387	H141Q	probably benign	Het
Numbl	G	A	7: 27,280,990	D466N	probably damaging	Het
Olfr1100	A	T	2: 86,978,322	V158D	possibly damaging	Het
Olfr1186	T	C	2: 88,526,041	S153P	probably damaging	Het
Olfr167	A	G	16: 19,515,027	I203T	probably benign	Het
Olfr310	A	G	7: 86,269,591	I66T	probably damaging	Het
Olfr606	A	T	7: 103,451,410	E24D	probably benign	Het
Olfr668	A	C	7: 104,925,493	N90K	probably benign	Het
Olfr986	T	C	9: 40,187,664	L183S	probably damaging	Het
Pik3c2g	T	A	6: 139,720,147	C65S	probably null	Het
Plagl1	A	G	10: 13,127,261	Y91C	probably damaging	Het
Polr1a	A	G	6: 71,931,709	N506S	possibly damaging	Het
Pomt2	A	C	12: 87,133,460	C256G	probably damaging	Het
Psg29	T	A	7: 17,211,838	D444E	probably damaging	Het
Ptgs1	A	T	2: 36,251,260	N573I	probably damaging	Het
Ptprf	C	A	4: 118,211,999	G1624W	probably damaging	Het
Rbm38	C	T	2: 173,022,082	P15S	probably benign	Het
Rc3h1	A	G	1: 160,959,477	D814G	possibly damaging	Het
Rnf40	T	C	7: 127,597,286	L802P	probably damaging	Het
Rusc2	A	G	4: 43,415,240	D182G	probably benign	Het
Setd1b	A	G	5: 123,160,914		probably benign	Het
Slc4a2	G	A	5: 24,438,762	S855N	probably benign	Het
Slc8a2	T	C	7: 16,150,583	L626P	possibly damaging	Het
Slirp	A	G	12: 87,444,014	T29A	probably damaging	Het
Smarcc2	A	G	10: 128,463,940	D158G	probably damaging	Het
Sptbn1	A	G	11: 30,113,854		probably null	Het
St3gal5	T	C	6: 72,132,053	C42R	probably damaging	Het
Syt7	T	C	19: 10,443,428	S397P	possibly damaging	Het
Thada	T	A	17: 84,386,532	D1263V	probably damaging	Het
Tmco3	G	T	8: 13,292,860	E199*	probably null	Het
Tpcn1	A	T	5: 120,548,269		probably null	Het
Tppp2	G	A	14: 51,920,455	R119Q	probably benign	Het
Trim30d	A	C	7: 104,487,958	V13G	probably damaging	Het
Ubxn2b	A	T	4: 6,214,746	Q260L	probably damaging	Het
Ufl1	A	G	4: 25,254,780	Y559H	probably benign	Het
Usp5	A	G	6: 124,826,379	F7L	probably benign	Het
Utrn	A	T	10: 12,384,204		probably null	Het
Vmn1r28	A	T	6: 58,265,909	I246F	probably benign	Het
Vmn2r2	C	A	3: 64,116,900	M753I	probably benign	Het
Zbtb26	T	C	2: 37,435,929	H365R	probably benign	Het
Zfp976	A	T	7: 42,612,930	Y494*	probably null	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACATAAGGCCCCTGGAAGAG -3'
(R):5'- GGTAGATCAACCATGTGTTTCCC -3'

Sequencing Primer
(F):5'- CCCCTGGAAGAGAGATTGTTG -3'
(R):5'- GAAATTGAGCTCCCTGGTACCAATG -3'

Posted On

2016-06-06