Incidental Mutation 'R5071:Inf2'
ID388805
Institutional Source Beutler Lab
Gene Symbol Inf2
Ensembl Gene ENSMUSG00000037679
Gene Nameinverted formin, FH2 and WH2 domain containing
Synonyms2610204M08Rik, EG629699
MMRRC Submission 042661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5071 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112588784-112615557 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 112612039 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000101029]
Predicted Effect probably null
Transcript: ENSMUST00000101029
SMART Domains Protein: ENSMUSP00000098591
Gene: ENSMUSG00000037679

DomainStartEndE-ValueType
Drf_GBD 1 152 3.47e-34 SMART
Drf_FH3 156 343 2.18e-58 SMART
low complexity region 359 382 N/A INTRINSIC
low complexity region 420 518 N/A INTRINSIC
low complexity region 525 557 N/A INTRINSIC
FH2 587 1030 1.96e-53 SMART
WH2 1005 1020 1.68e-2 SMART
Blast:FH2 1049 1179 3e-28 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000222275
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display placental vasculopathy, restricted fetal growth, increased gestational length and transient increase in maternal blood pressure in the late stages of pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI182371 A T 2: 35,085,215 I334N probably benign Het
Aldh1b1 A G 4: 45,803,383 probably null Het
Armc9 G A 1: 86,186,116 M298I probably benign Het
Atp8a1 T A 5: 67,815,723 K27N probably benign Het
BC004004 G A 17: 29,294,415 probably null Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh17 G T 4: 11,810,325 G672V probably damaging Het
Cdh5 C A 8: 104,140,702 T537K probably damaging Het
Chd1 T A 17: 15,762,405 S1377R probably benign Het
Chd2 T C 7: 73,429,689 N1821S probably benign Het
Cnot3 A G 7: 3,650,861 K4R probably damaging Het
Colq T A 14: 31,528,832 I339F possibly damaging Het
Coq2 A T 5: 100,667,950 L121Q probably damaging Het
Csnk1e G A 15: 79,420,872 R342* probably null Het
Cstl1 A T 2: 148,750,927 M1L probably benign Het
Cwh43 A G 5: 73,423,913 probably null Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dgkh T C 14: 78,604,532 K417E probably damaging Het
Dnah11 A T 12: 118,082,453 L1750* probably null Het
Edn1 A G 13: 42,303,677 E62G probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Fitm1 T A 14: 55,575,773 V31E possibly damaging Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gabrd A C 4: 155,387,162 F228C probably damaging Het
Gm5916 A C 9: 36,128,668 L8R probably benign Het
Gm9573 G A 17: 35,620,552 probably benign Het
Gpr108 A G 17: 57,235,335 S557P probably damaging Het
Gpr75 C A 11: 30,892,380 N428K probably damaging Het
H2-M5 T G 17: 36,987,184 probably null Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Homer3 T C 8: 70,291,355 V243A probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi203 T C 1: 173,935,110 Q152R possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ighv1-24 A G 12: 114,773,128 Y51H probably benign Het
Insl6 T C 19: 29,325,255 R21G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Ltbp3 T C 19: 5,756,823 C1043R probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mpeg1 T A 19: 12,461,181 M1K probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nek9 C A 12: 85,327,459 R268L possibly damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1186 T C 2: 88,526,041 S153P probably damaging Het
Olfr167 A G 16: 19,515,027 I203T probably benign Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr986 T C 9: 40,187,664 L183S probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Plagl1 A G 10: 13,127,261 Y91C probably damaging Het
Polr1a A G 6: 71,931,709 N506S possibly damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Ptprf C A 4: 118,211,999 G1624W probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Rc3h1 A G 1: 160,959,477 D814G possibly damaging Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Rusc2 A G 4: 43,415,240 D182G probably benign Het
Setd1b A G 5: 123,160,914 probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Smarcc2 A G 10: 128,463,940 D158G probably damaging Het
Sptbn1 A G 11: 30,113,854 probably null Het
St3gal5 T C 6: 72,132,053 C42R probably damaging Het
Syt7 T C 19: 10,443,428 S397P possibly damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Thada T A 17: 84,386,532 D1263V probably damaging Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tpcn1 A T 5: 120,548,269 probably null Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Ubxn2b A T 4: 6,214,746 Q260L probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp5 A G 6: 124,826,379 F7L probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn1r28 A T 6: 58,265,909 I246F probably benign Het
Vmn2r2 C A 3: 64,116,900 M753I probably benign Het
Zbtb26 T C 2: 37,435,929 H365R probably benign Het
Zfp976 A T 7: 42,612,930 Y494* probably null Het
Other mutations in Inf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Inf2 APN 12 112611856 nonsense probably null
IGL01582:Inf2 APN 12 112610559 missense unknown
IGL02078:Inf2 APN 12 112601614 missense probably damaging 1.00
IGL02534:Inf2 APN 12 112610496 missense unknown
IGL03122:Inf2 APN 12 112604229 missense probably benign 0.03
IGL03296:Inf2 APN 12 112604208 nonsense probably null
Talon UTSW 12 112610287 splice site probably benign
R0413:Inf2 UTSW 12 112601676 missense probably damaging 1.00
R0552:Inf2 UTSW 12 112612574 intron probably benign
R0920:Inf2 UTSW 12 112610287 splice site probably benign
R1240:Inf2 UTSW 12 112610776 missense unknown
R1452:Inf2 UTSW 12 112601344 missense probably damaging 0.99
R1974:Inf2 UTSW 12 112608337 missense unknown
R2422:Inf2 UTSW 12 112610824 missense unknown
R3877:Inf2 UTSW 12 112610830 missense unknown
R4108:Inf2 UTSW 12 112607581 missense unknown
R4490:Inf2 UTSW 12 112600204 missense probably damaging 1.00
R5074:Inf2 UTSW 12 112612039 splice site probably null
R5306:Inf2 UTSW 12 112601553 missense probably benign 0.26
R5383:Inf2 UTSW 12 112600145 missense probably damaging 0.99
R5569:Inf2 UTSW 12 112601679 missense possibly damaging 0.80
R5664:Inf2 UTSW 12 112611728 missense unknown
R6157:Inf2 UTSW 12 112604788 unclassified probably benign
R6221:Inf2 UTSW 12 112603745 missense possibly damaging 0.66
R6429:Inf2 UTSW 12 112604256 missense probably benign 0.01
R6955:Inf2 UTSW 12 112610731 missense unknown
R7423:Inf2 UTSW 12 112609738 missense unknown
R7444:Inf2 UTSW 12 112605387 missense unknown
R7496:Inf2 UTSW 12 112600318 missense probably damaging 1.00
R7605:Inf2 UTSW 12 112601337 missense probably damaging 1.00
R7678:Inf2 UTSW 12 112606994 missense unknown
R7708:Inf2 UTSW 12 112607557 missense unknown
R7752:Inf2 UTSW 12 112609684 missense unknown
R7903:Inf2 UTSW 12 112612554 missense unknown
R8024:Inf2 UTSW 12 112608902 missense unknown
R8118:Inf2 UTSW 12 112601437 missense probably damaging 0.99
R8139:Inf2 UTSW 12 112601640 nonsense probably null
R8229:Inf2 UTSW 12 112611596 missense unknown
R8299:Inf2 UTSW 12 112604112 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAGAGGATGAAGCTCAGC -3'
(R):5'- GAATCACCCTCTCTCCTGGATG -3'

Sequencing Primer
(F):5'- CTCAGCGAGGACAGAGCAC -3'
(R):5'- GCTGGTTGAGCCTGTAGGACC -3'
Posted On2016-06-06