Incidental Mutation 'R5071:Adcy8'
ID388816
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
SynonymsAC8
MMRRC Submission 042661-MU
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5071 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64787358 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 528 (W528R)
Ref Sequence ENSEMBL: ENSMUSP00000154029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
Predicted Effect probably damaging
Transcript: ENSMUST00000023007
AA Change: W528R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: W528R

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228014
AA Change: W528R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228109
Meta Mutation Damage Score 0.9704 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI182371 A T 2: 35,085,215 I334N probably benign Het
Aldh1b1 A G 4: 45,803,383 probably null Het
Armc9 G A 1: 86,186,116 M298I probably benign Het
Atp8a1 T A 5: 67,815,723 K27N probably benign Het
BC004004 G A 17: 29,294,415 probably null Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh17 G T 4: 11,810,325 G672V probably damaging Het
Cdh5 C A 8: 104,140,702 T537K probably damaging Het
Chd1 T A 17: 15,762,405 S1377R probably benign Het
Chd2 T C 7: 73,429,689 N1821S probably benign Het
Cnot3 A G 7: 3,650,861 K4R probably damaging Het
Colq T A 14: 31,528,832 I339F possibly damaging Het
Coq2 A T 5: 100,667,950 L121Q probably damaging Het
Csnk1e G A 15: 79,420,872 R342* probably null Het
Cstl1 A T 2: 148,750,927 M1L probably benign Het
Cwh43 A G 5: 73,423,913 probably null Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dgkh T C 14: 78,604,532 K417E probably damaging Het
Dnah11 A T 12: 118,082,453 L1750* probably null Het
Edn1 A G 13: 42,303,677 E62G probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Fitm1 T A 14: 55,575,773 V31E possibly damaging Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gabrd A C 4: 155,387,162 F228C probably damaging Het
Gm5916 A C 9: 36,128,668 L8R probably benign Het
Gm9573 G A 17: 35,620,552 probably benign Het
Gpr108 A G 17: 57,235,335 S557P probably damaging Het
Gpr75 C A 11: 30,892,380 N428K probably damaging Het
H2-M5 T G 17: 36,987,184 probably null Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Homer3 T C 8: 70,291,355 V243A probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi203 T C 1: 173,935,110 Q152R possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ighv1-24 A G 12: 114,773,128 Y51H probably benign Het
Inf2 A T 12: 112,612,039 probably null Het
Insl6 T C 19: 29,325,255 R21G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Ltbp3 T C 19: 5,756,823 C1043R probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mpeg1 T A 19: 12,461,181 M1K probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nek9 C A 12: 85,327,459 R268L possibly damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1186 T C 2: 88,526,041 S153P probably damaging Het
Olfr167 A G 16: 19,515,027 I203T probably benign Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr986 T C 9: 40,187,664 L183S probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Plagl1 A G 10: 13,127,261 Y91C probably damaging Het
Polr1a A G 6: 71,931,709 N506S possibly damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Ptprf C A 4: 118,211,999 G1624W probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Rc3h1 A G 1: 160,959,477 D814G possibly damaging Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Rusc2 A G 4: 43,415,240 D182G probably benign Het
Setd1b A G 5: 123,160,914 probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Smarcc2 A G 10: 128,463,940 D158G probably damaging Het
Sptbn1 A G 11: 30,113,854 probably null Het
St3gal5 T C 6: 72,132,053 C42R probably damaging Het
Syt7 T C 19: 10,443,428 S397P possibly damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Thada T A 17: 84,386,532 D1263V probably damaging Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tpcn1 A T 5: 120,548,269 probably null Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Ubxn2b A T 4: 6,214,746 Q260L probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp5 A G 6: 124,826,379 F7L probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn1r28 A T 6: 58,265,909 I246F probably benign Het
Vmn2r2 C A 3: 64,116,900 M753I probably benign Het
Zbtb26 T C 2: 37,435,929 H365R probably benign Het
Zfp976 A T 7: 42,612,930 Y494* probably null Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 unclassified probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64921033 missense probably benign
R7644:Adcy8 UTSW 15 64699369 missense possibly damaging 0.77
R7697:Adcy8 UTSW 15 64747001 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCCTCCTGGACAATTGC -3'
(R):5'- CACGGAGAAAGGACCATTTTAGTAG -3'

Sequencing Primer
(F):5'- CCTGGACAATTGCTTCTGAGGAG -3'
(R):5'- GGAGTAAACAGCTCTAATTCTGCC -3'
Posted On2016-06-06