Incidental Mutation 'R0432:Dnmbp'
ID38883
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Namedynamin binding protein
Synonyms2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission 038634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0432 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location43846821-43940191 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 43854857 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 432 (Y432*)
Ref Sequence ENSEMBL: ENSMUSP00000148421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396] [ENSMUST00000212592]
Predicted Effect probably null
Transcript: ENSMUST00000026209
AA Change: Y1189*
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195
AA Change: Y1189*

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157865
Predicted Effect probably null
Transcript: ENSMUST00000212032
AA Change: Y1185*
Predicted Effect probably null
Transcript: ENSMUST00000212048
AA Change: Y873*
Predicted Effect probably null
Transcript: ENSMUST00000212396
AA Change: Y1189*
Predicted Effect probably null
Transcript: ENSMUST00000212592
AA Change: Y432*
Meta Mutation Damage Score 0.9708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,816 L110P probably damaging Het
4930522L14Rik A T 5: 109,736,919 C358S probably damaging Het
9330182L06Rik G T 5: 9,440,966 G659* probably null Het
Abca8b C A 11: 109,980,015 V104F possibly damaging Het
Afap1l2 T C 19: 56,917,119 probably benign Het
Ahctf1 A C 1: 179,784,161 I548R probably damaging Het
Alox12b G T 11: 69,169,556 G646V probably damaging Het
Aoah C T 13: 20,911,198 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Atxn1l A G 8: 109,731,693 W646R probably damaging Het
Cabp2 T C 19: 4,084,903 I28T possibly damaging Het
Cacna1b G A 2: 24,687,704 T719I probably damaging Het
Camk1d A T 2: 5,445,135 H70Q probably damaging Het
Car1 T C 3: 14,770,176 T170A probably benign Het
Ccdc162 T C 10: 41,541,860 T2113A probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh17 T A 4: 11,771,273 C18* probably null Het
Cdk17 A T 10: 93,237,790 probably benign Het
Chd9 T A 8: 90,994,450 probably benign Het
Chrm5 T A 2: 112,479,655 K372M possibly damaging Het
Clasp2 A G 9: 113,909,419 T423A probably benign Het
Col11a1 A G 3: 114,205,901 probably benign Het
Col27a1 T C 4: 63,225,611 M512T possibly damaging Het
Dclk3 A G 9: 111,484,935 D693G probably damaging Het
Dcun1d3 T A 7: 119,857,950 K180* probably null Het
Dmxl2 T C 9: 54,416,951 R876G probably benign Het
Eml2 C T 7: 19,179,531 Q125* probably null Het
Faap100 A C 11: 120,373,876 probably benign Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gda A G 19: 21,417,107 Y129H probably damaging Het
Gga3 G A 11: 115,590,524 R207C probably damaging Het
Glg1 T C 8: 111,182,569 I496M probably damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10322 A T 10: 59,616,208 H49L possibly damaging Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Gramd3 G A 18: 56,474,069 C85Y probably benign Het
Grhl1 C T 12: 24,582,919 P153L probably benign Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hdlbp T C 1: 93,425,332 I414V probably damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Lipe G A 7: 25,398,488 P10L probably benign Het
Lrrc8a A G 2: 30,257,067 E631G probably damaging Het
Lvrn T A 18: 46,905,299 N973K possibly damaging Het
Man2c1 T A 9: 57,135,597 H250Q probably damaging Het
Mup3 T C 4: 62,085,282 T117A probably benign Het
Myo6 A C 9: 80,273,974 probably benign Het
Nbn T A 4: 15,983,951 probably benign Het
Ncapg T A 5: 45,672,428 N157K probably damaging Het
Olfr1024 T A 2: 85,904,157 N299I probably damaging Het
Olfr1137 G A 2: 87,711,430 H159Y probably benign Het
Olfr1154 T C 2: 87,902,960 T239A probably damaging Het
Olfr1178 C T 2: 88,392,033 T262I probably damaging Het
Olfr1434 T A 19: 12,283,903 M285K probably damaging Het
P4ha1 T A 10: 59,348,257 Y180* probably null Het
Pcdhb19 T A 18: 37,499,535 F794L probably benign Het
Pdxdc1 T A 16: 13,854,400 I379F probably damaging Het
Psme3 T A 11: 101,320,442 S185T possibly damaging Het
Ptgr1 A G 4: 58,978,045 S116P probably damaging Het
Ptpn23 A T 9: 110,389,010 probably null Het
Rabgap1l A C 1: 160,722,205 I277R probably benign Het
Rapgef1 C T 2: 29,679,816 T93I possibly damaging Het
Rbp3 A T 14: 33,954,773 D226V probably damaging Het
Rnf144a A T 12: 26,339,329 C38S probably damaging Het
Rptor C T 11: 119,780,553 Q281* probably null Het
Rragd T C 4: 33,004,332 L208S probably damaging Het
Slc12a4 T C 8: 105,959,488 E41G probably damaging Het
Slc16a1 G T 3: 104,653,419 V347F probably benign Het
Slit1 G A 19: 41,743,293 T39I probably damaging Het
Sra1 T C 18: 36,677,503 N98S probably benign Het
Ssx2ip T C 3: 146,426,429 L215P probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Tep1 TTTCTTCTTCTT TTTCTTCTT 14: 50,866,823 probably benign Het
Tgfbi T C 13: 56,632,191 probably benign Het
Tmem232 T C 17: 65,256,503 M632V probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnnt3 T G 7: 142,512,086 D153E probably benign Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Tpsab1 A G 17: 25,343,824 probably benign Het
Usp34 T A 11: 23,401,505 V1431D probably damaging Het
Wdr49 G T 3: 75,450,022 R285S possibly damaging Het
Wdr7 A G 18: 63,796,249 Y1052C probably damaging Het
Zan A T 5: 137,382,316 probably benign Het
Zfp652 G A 11: 95,763,739 V323I possibly damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zfp874b A G 13: 67,481,836 S10P probably damaging Het
Zmynd19 A G 2: 24,958,122 Y110C probably benign Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTCTTTCGAGCCAGCCCTTAAGATG -3'
(R):5'- GCTCCTGGACTTCTACAACTGCAC -3'

Sequencing Primer
(F):5'- GGTTTCACAGCACCATGAATG -3'
(R):5'- TTCTACAACTGCACTGAGCGAG -3'
Posted On2013-05-23