Incidental Mutation 'R5072:Pygb'
ID388849
Institutional Source Beutler Lab
Gene Symbol Pygb
Ensembl Gene ENSMUSG00000033059
Gene Namebrain glycogen phosphorylase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150786735-150831758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150801578 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 95 (T95M)
Ref Sequence ENSEMBL: ENSMUSP00000035743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441]
Predicted Effect probably damaging
Transcript: ENSMUST00000045441
AA Change: T95M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059
AA Change: T95M

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139938
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen phosphorylase found predominantly in the brain. The encoded protein forms homodimers which can associate into homotetramers, the enzymatically active form of glycogen phosphorylase. The activity of this enzyme is positively regulated by AMP and negatively regulated by ATP, ADP, and glucose-6-phosphate. This enzyme catalyzes the rate-determining step in glycogen degradation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Pygb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Pygb APN 2 150819913 missense probably benign 0.00
IGL01395:Pygb APN 2 150801583 missense probably benign 0.04
IGL01571:Pygb APN 2 150830473 missense probably benign 0.00
IGL01960:Pygb APN 2 150813483 missense probably benign 0.00
IGL03118:Pygb APN 2 150820811 missense probably benign 0.01
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0423:Pygb UTSW 2 150823984 missense probably benign
R0545:Pygb UTSW 2 150815706 missense probably benign 0.00
R0674:Pygb UTSW 2 150815134 splice site probably null
R1052:Pygb UTSW 2 150786938 missense probably benign 0.00
R1590:Pygb UTSW 2 150817663 missense possibly damaging 0.94
R1706:Pygb UTSW 2 150827147 missense probably damaging 1.00
R1786:Pygb UTSW 2 150816772 missense probably damaging 0.98
R2405:Pygb UTSW 2 150820775 missense probably benign 0.04
R3522:Pygb UTSW 2 150828553 missense probably benign 0.07
R4082:Pygb UTSW 2 150826471 critical splice donor site probably null
R4319:Pygb UTSW 2 150815614 splice site probably benign
R4662:Pygb UTSW 2 150815116 missense probably benign
R5665:Pygb UTSW 2 150820888 splice site probably null
R5874:Pygb UTSW 2 150786878 missense probably benign 0.11
R5910:Pygb UTSW 2 150815700 missense probably benign 0.00
R6610:Pygb UTSW 2 150823966 splice site probably null
R6820:Pygb UTSW 2 150816754 missense possibly damaging 0.88
R7348:Pygb UTSW 2 150786983 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACTCAGCAGTAAGGTGTCAGG -3'
(R):5'- AAAACCTACCCCTGGACTGG -3'

Sequencing Primer
(F):5'- GATTGGGGTCCCATGAAAGTCCTAC -3'
(R):5'- GAAGGGAGTACATTTCTAGAAACTTC -3'
Posted On2016-06-06