Incidental Mutation 'R5072:Sdcbp'
ID388854
Institutional Source Beutler Lab
Gene Symbol Sdcbp
Ensembl Gene ENSMUSG00000028249
Gene Namesyndecan binding protein
Synonymssyntenin-1, syndecan interacting protein, syntenin, Sycl, MDA-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location6365650-6408423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6393019 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 218 (I218V)
Ref Sequence ENSEMBL: ENSMUSP00000100073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000029912] [ENSMUST00000103008] [ENSMUST00000108374] [ENSMUST00000153861] [ENSMUST00000175769]
Predicted Effect probably benign
Transcript: ENSMUST00000029910
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029912
AA Change: I219V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029912
Gene: ENSMUSG00000028249
AA Change: I219V

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
PDZ 208 274 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103008
AA Change: I218V

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100073
Gene: ENSMUSG00000028249
AA Change: I218V

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
PDZ 207 273 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108374
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149015
Predicted Effect probably benign
Transcript: ENSMUST00000153861
SMART Domains Protein: ENSMUSP00000119838
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156715
Predicted Effect probably benign
Transcript: ENSMUST00000175769
AA Change: I219V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135777
Gene: ENSMUSG00000028249
AA Change: I219V

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
Blast:PDZ 208 249 1e-21 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was initially identified as a molecule linking syndecan-mediated signaling to the cytoskeleton. The syntenin protein contains tandemly repeated PDZ domains that bind the cytoplasmic, C-terminal domains of a variety of transmembrane proteins. This protein may also affect cytoskeletal-membrane organization, cell adhesion, protein trafficking, and the activation of transcription factors. The protein is primarily localized to membrane-associated adherens junctions and focal adhesions but is also found at the endoplasmic reticulum and nucleus. Alternative splicing results in multiple transcript variants encoding different isoforms. Related pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice heterozygous for a conditional allele activated in neurons exhibit abnormal dendrite morphology and reduced mEPSC frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Sdcbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Sdcbp APN 4 6392953 nonsense probably null
R0158:Sdcbp UTSW 4 6379042 missense possibly damaging 0.81
R1066:Sdcbp UTSW 4 6385120 missense probably damaging 0.98
R1115:Sdcbp UTSW 4 6377143 critical splice donor site probably null
R1353:Sdcbp UTSW 4 6381057 missense probably damaging 0.99
R2006:Sdcbp UTSW 4 6386536 missense probably benign 0.23
R4879:Sdcbp UTSW 4 6381056 missense possibly damaging 0.93
R4979:Sdcbp UTSW 4 6378980 nonsense probably null
R5034:Sdcbp UTSW 4 6393118 critical splice donor site probably null
R6307:Sdcbp UTSW 4 6385059 missense probably benign 0.06
R6329:Sdcbp UTSW 4 6381064 missense probably benign 0.04
R7483:Sdcbp UTSW 4 6393089 missense possibly damaging 0.95
R7665:Sdcbp UTSW 4 6385144 missense probably benign 0.11
R7722:Sdcbp UTSW 4 6385063 missense possibly damaging 0.93
R7729:Sdcbp UTSW 4 6378985 missense probably benign 0.06
R7807:Sdcbp UTSW 4 6393688 missense probably damaging 1.00
R8025:Sdcbp UTSW 4 6393022 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTTAGAAACACCACTTTCTGTATC -3'
(R):5'- CTAGCTCAAGGGATTCCAGG -3'

Sequencing Primer
(F):5'- TCAAAATATCCCATGTGGCAGAG -3'
(R):5'- CAGATGTGGTGATCAGTG -3'
Posted On2016-06-06