Incidental Mutation 'R5072:Pilra'
ID388868
Institutional Source Beutler Lab
Gene Symbol Pilra
Ensembl Gene ENSMUSG00000046245
Gene Namepaired immunoglobin-like type 2 receptor alpha
SynonymsFDF03
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137821952-137836281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137835412 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 131 (F131L)
Ref Sequence ENSEMBL: ENSMUSP00000050313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058897] [ENSMUST00000110980] [ENSMUST00000197586] [ENSMUST00000199028]
Predicted Effect probably damaging
Transcript: ENSMUST00000058897
AA Change: F131L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050313
Gene: ENSMUSG00000046245
AA Change: F131L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Blast:IG 45 155 3e-69 BLAST
low complexity region 156 176 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110980
AA Change: F128L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106608
Gene: ENSMUSG00000046245
AA Change: F128L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 42 152 1e-68 BLAST
low complexity region 153 173 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130460
Predicted Effect probably benign
Transcript: ENSMUST00000197586
SMART Domains Protein: ENSMUSP00000142631
Gene: ENSMUSG00000046245

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Blast:IG 42 94 8e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199028
SMART Domains Protein: ENSMUSP00000142391
Gene: ENSMUSG00000046245

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Meta Mutation Damage Score 0.7047 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell signaling pathways rely on a dynamic interaction between activating and inhibiting processes. SHP-1-mediated dephosphorylation of protein tyrosine residues is central to the regulation of several cell signaling pathways. Two types of inhibitory receptor superfamily members are immunoreceptor tyrosine-based inhibitory motif (ITIM)-bearing receptors and their non-ITIM-bearing, activating counterparts. Control of cell signaling via SHP-1 is thought to occur through a balance between PILRalpha-mediated inhibition and PILRbeta-mediated activation. These paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This particular gene encodes the ITIM-bearing member of the receptor pair, which functions in the inhibitory role. Alternative splicing has been observed at this locus and three variants, each encoding a distinct isoform, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased increased alanine transferase, blood urea nitrogen, lactate dehydrogenase, neutrophils and mortality and altered liver morphology (massive hemorrhage, disorganized hepatic cords and karyolysis of hepatocytes) following treatment with LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Pilra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Pilra APN 5 137835541 missense probably damaging 1.00
IGL02331:Pilra APN 5 137835655 nonsense probably null
IGL02815:Pilra APN 5 137831305 missense probably benign 0.00
IGL03067:Pilra APN 5 137823581 missense probably damaging 0.99
R0032:Pilra UTSW 5 137831265 missense probably damaging 1.00
R0032:Pilra UTSW 5 137831265 missense probably damaging 1.00
R2851:Pilra UTSW 5 137836080 missense probably benign 0.03
R2852:Pilra UTSW 5 137836080 missense probably benign 0.03
R4250:Pilra UTSW 5 137823552 missense probably benign 0.27
R4359:Pilra UTSW 5 137831314 missense probably benign 0.00
R4655:Pilra UTSW 5 137835326 splice site probably null
R4684:Pilra UTSW 5 137835515 missense probably damaging 1.00
R4744:Pilra UTSW 5 137835507 unclassified probably null
R5001:Pilra UTSW 5 137835515 missense probably damaging 1.00
R5073:Pilra UTSW 5 137835412 missense probably damaging 0.97
R5074:Pilra UTSW 5 137835412 missense probably damaging 0.97
R5337:Pilra UTSW 5 137835770 intron probably benign
R5349:Pilra UTSW 5 137831226 missense probably damaging 0.98
R5479:Pilra UTSW 5 137836056 missense possibly damaging 0.48
R6233:Pilra UTSW 5 137823501 missense possibly damaging 0.66
R6542:Pilra UTSW 5 137821975 unclassified probably null
R7103:Pilra UTSW 5 137831226 missense possibly damaging 0.80
R7714:Pilra UTSW 5 137835417 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAAAGTTGGCAGACCTCTGG -3'
(R):5'- GATCCACAGATGAGCATAGCCTG -3'

Sequencing Primer
(F):5'- CCACAGGAGAAAAATCTGTGTG -3'
(R):5'- CATAGCCTGGAGATGGAAGGATTTC -3'
Posted On2016-06-06