Mutagenetix > Incidental Mutation

Incidental Mutation 'R5072:Pik3c2g'

388871

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R5072 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139720147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 65 (C65S)

Ref Sequence

ENSEMBL: ENSMUSP00000107499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111868]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000111868
AA Change: C65S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: C65S

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187069

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 95.9%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,853,600	H104Q	probably benign	Het
4933405L10Rik	A	G	8: 105,709,569	T158A	possibly damaging	Het
A1cf	T	C	19: 31,917,985	M156T	probably benign	Het
Abca15	A	G	7: 120,406,975	Y1620C	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox2	A	T	14: 8,241,374	Y579*	probably null	Het
Adnp	A	T	2: 168,183,001	S791R	probably damaging	Het
Agbl1	A	G	7: 76,421,917	E329G	probably damaging	Het
Alx3	G	T	3: 107,604,793	S249I	possibly damaging	Het
Apob	A	G	12: 8,008,714	T2366A	probably benign	Het
Apool	C	T	X: 112,349,843	Q60*	probably null	Het
Arid4a	T	C	12: 71,045,079	V213A	probably benign	Het
Atp7a	A	G	X: 106,109,768	D1092G	probably benign	Het
Bpifa5	A	T	2: 154,165,972	E178V	probably damaging	Het
Car4	G	A	11: 84,963,367	E47K	probably benign	Het
Catsper1	T	C	19: 5,340,046		probably null	Het
Ccdc63	T	A	5: 122,121,055	Q260L	probably benign	Het
Ccdc83	A	T	7: 90,250,529	F45Y	probably damaging	Het
Cct8l1	G	A	5: 25,516,883	V199I	probably benign	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Ces5a	C	T	8: 93,534,668	V44M	probably damaging	Het
Cltc	A	G	11: 86,717,968	I741T	possibly damaging	Het
Cnst	C	A	1: 179,622,886	D638E	possibly damaging	Het
Col13a1	A	G	10: 61,874,018		silent	Het
Cyp2a22	A	T	7: 26,932,481	F450Y	probably benign	Het
Cyp2d10	C	T	15: 82,403,753	R383H	probably benign	Het
Cyp4a29	A	G	4: 115,247,663	T123A	probably benign	Het
Ddx20	A	G	3: 105,682,875		probably null	Het
Dnaja3	A	T	16: 4,696,425	T274S	probably damaging	Het
Dot1l	A	G	10: 80,784,646	D514G	possibly damaging	Het
Dysf	A	T	6: 84,137,272	K1226M	probably damaging	Het
Epha4	T	C	1: 77,445,002	Y281C	probably damaging	Het
Fbxo42	T	C	4: 141,198,945	W313R	probably damaging	Het
Fign	A	T	2: 63,979,693	L411*	probably null	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Fryl	G	A	5: 73,074,767	P1550L	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gprasp2	C	T	X: 135,842,597	T235I	possibly damaging	Het
Gtf2ird1	G	T	5: 134,390,933		probably null	Het
H2afb3	T	C	X: 120,312,846	T84A	probably damaging	Het
Hal	A	T	10: 93,514,042	I555F	probably damaging	Het
Hdac6	A	G	X: 7,944,797	F104L	probably damaging	Homo
Hist2h2ac	C	T	3: 96,220,783		probably benign	Het
Hspg2	T	C	4: 137,540,230	S2050P	probably damaging	Het
Irgc1	T	C	7: 24,432,771	D207G	probably benign	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Kiss1r	C	A	10: 79,918,762	S30*	probably null	Het
Krtap1-4	C	G	11: 99,583,616		probably benign	Het
Lrrfip2	A	G	9: 111,199,804	E365G	probably damaging	Het
Ly75	A	G	2: 60,375,963	Y121H	probably damaging	Het
Man2a1	G	A	17: 64,659,079		probably null	Het
Mkl1	A	G	15: 81,022,426	V91A	probably damaging	Het
Mllt10	C	A	2: 18,109,874	H52N	possibly damaging	Het
Myo1a	T	C	10: 127,707,419		probably null	Het
Myo3b	C	A	2: 70,095,249	T20K	possibly damaging	Het
Nipsnap2	A	T	5: 129,739,580	K62N	probably damaging	Het
Nr1i3	C	T	1: 171,216,813	T169I	probably benign	Het
Numbl	G	A	7: 27,280,990	D466N	probably damaging	Het
Olfr1100	A	T	2: 86,978,322	V158D	possibly damaging	Het
Olfr310	A	G	7: 86,269,591	I66T	probably damaging	Het
Olfr420	A	T	1: 174,158,961	I63F	probably damaging	Het
Olfr639	T	A	7: 104,012,118	R195W	probably damaging	Het
Oprm1	A	G	10: 6,832,550	S398G	probably benign	Het
Pebp1	G	T	5: 117,283,410	D156E	probably benign	Het
Pilra	A	G	5: 137,835,412	F131L	probably damaging	Het
Pitrm1	T	C	13: 6,553,190	F91S	probably damaging	Het
Ppl	A	T	16: 5,088,878	S1184R	probably benign	Het
Prmt2	C	T	10: 76,222,556	V140I	probably damaging	Het
Psg29	T	A	7: 17,211,838	D444E	probably damaging	Het
Ptgs1	A	T	2: 36,251,260	N573I	probably damaging	Het
Pygb	C	T	2: 150,801,578	T95M	probably damaging	Het
Rassf9	A	G	10: 102,545,905	K383E	probably damaging	Het
Rfk	T	A	19: 17,398,599	F86I	possibly damaging	Het
Rims2	T	C	15: 39,462,590	F773L	probably benign	Het
Sdcbp	A	G	4: 6,393,019	I218V	probably benign	Het
Slc4a2	G	A	5: 24,438,762	S855N	probably benign	Het
Slc8a2	T	C	7: 16,150,583	L626P	possibly damaging	Het
Snrpd3	G	T	10: 75,519,393	C20F	possibly damaging	Het
Spen	A	T	4: 141,522,302	S58R	unknown	Het
St3gal2	T	C	8: 110,957,718	C3R	possibly damaging	Het
Stab2	A	T	10: 86,863,558	I481N	probably benign	Het
Stat5b	T	C	11: 100,808,535		probably null	Het
Tmco3	G	T	8: 13,292,860	E199*	probably null	Het
Tmem26	A	G	10: 68,775,348	T216A	probably damaging	Het
Ttn	A	G	2: 76,720,478		probably null	Het
Ttn	C	T	2: 76,746,402	V24716I	probably damaging	Het
Ttn	A	T	2: 76,772,365		probably null	Het
Uba5	T	C	9: 104,054,427	E202G	probably damaging	Het
Ufl1	A	G	4: 25,254,780	Y559H	probably benign	Het
Utrn	A	T	10: 12,384,204		probably null	Het
Vmn2r111	C	A	17: 22,548,041	C825F	probably damaging	Het
Vmn2r113	T	A	17: 22,958,355	C704*	probably null	Het
Vmn2r56	A	G	7: 12,694,056	I761T	probably benign	Het
Vmn2r98	C	T	17: 19,066,044	T268I	probably benign	Het
Zfp263	A	G	16: 3,746,840	R240G	possibly damaging	Het
Zfp473	T	A	7: 44,732,519	I797F	probably damaging	Het
Zfp68	A	T	5: 138,606,317	D543E	probably benign	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
R8888:Pik3c2g	UTSW	6	139730366	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139875367	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139622403	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139875435	missense
R9383:Pik3c2g	UTSW	6	139882016	nonsense	probably null
R9524:Pik3c2g	UTSW	6	139629770	missense	probably damaging	0.99
R9531:Pik3c2g	UTSW	6	139896200	missense
R9630:Pik3c2g	UTSW	6	139622239	missense	possibly damaging	0.66
R9697:Pik3c2g	UTSW	6	139967791	missense	unknown
R9708:Pik3c2g	UTSW	6	139629867	missense	probably benign
R9717:Pik3c2g	UTSW	6	139896184	missense
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTTATGAGAAATACGACCCTTC -3'
(R):5'- AATGAGCCACAGTCTGTAGTC -3'

Sequencing Primer
(F):5'- TATGAGAAATACGACCCTTCACAGAC -3'
(R):5'- TGGTGAAAGGAAAATTAATACTCACC -3'

Posted On

2016-06-06