Incidental Mutation 'R5072:Ces5a'
ID388886
Institutional Source Beutler Lab
Gene Symbol Ces5a
Ensembl Gene ENSMUSG00000058019
Gene Namecarboxylesterase 5A
SynonymsCes7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93499064-93535830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93534668 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 44 (V44M)
Ref Sequence ENSEMBL: ENSMUSP00000148373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009] [ENSMUST00000212722]
Predicted Effect probably damaging
Transcript: ENSMUST00000077816
AA Change: V40M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: V40M

DomainStartEndE-ValueType
Pfam:COesterase 10 539 3.2e-157 PFAM
Pfam:Abhydrolase_3 141 238 9.5e-7 PFAM
low complexity region 552 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212009
AA Change: V40M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212722
AA Change: V44M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Ces5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces5a APN 8 93525544 critical splice donor site probably null
IGL01520:Ces5a APN 8 93519578 missense probably benign 0.08
IGL01674:Ces5a APN 8 93502219 missense probably damaging 1.00
IGL02257:Ces5a APN 8 93525598 missense probably benign 0.00
IGL02456:Ces5a APN 8 93528644 splice site probably benign
IGL03027:Ces5a APN 8 93523114 unclassified probably null
IGL03051:Ces5a APN 8 93528598 missense probably damaging 1.00
IGL03264:Ces5a APN 8 93502270 missense possibly damaging 0.74
IGL03290:Ces5a APN 8 93519632 missense probably damaging 1.00
R0115:Ces5a UTSW 8 93502183 missense probably damaging 0.98
R0124:Ces5a UTSW 8 93528555 missense probably damaging 1.00
R0521:Ces5a UTSW 8 93525658 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1524:Ces5a UTSW 8 93525665 missense probably damaging 0.96
R1843:Ces5a UTSW 8 93514231 missense probably damaging 1.00
R2029:Ces5a UTSW 8 93534577 missense probably damaging 1.00
R2135:Ces5a UTSW 8 93499741 missense probably benign 0.33
R2146:Ces5a UTSW 8 93534699 missense probably benign 0.03
R2973:Ces5a UTSW 8 93528504 missense probably damaging 1.00
R3755:Ces5a UTSW 8 93528502 missense probably benign 0.15
R4755:Ces5a UTSW 8 93535677 missense probably benign 0.39
R5278:Ces5a UTSW 8 93525638 missense probably damaging 1.00
R5419:Ces5a UTSW 8 93499431 missense unknown
R5825:Ces5a UTSW 8 93525667 missense probably damaging 1.00
R6318:Ces5a UTSW 8 93534583 missense probably damaging 1.00
R6925:Ces5a UTSW 8 93523057 intron probably null
R6950:Ces5a UTSW 8 93530774 missense probably benign 0.10
R7148:Ces5a UTSW 8 93502322 missense probably damaging 1.00
R7256:Ces5a UTSW 8 93499526 missense probably benign 0.13
R7290:Ces5a UTSW 8 93534683 missense probably damaging 1.00
R7459:Ces5a UTSW 8 93535741 start gained probably benign
R7674:Ces5a UTSW 8 93514269 missense probably damaging 1.00
R7815:Ces5a UTSW 8 93520995 missense possibly damaging 0.79
R8150:Ces5a UTSW 8 93530802 missense probably damaging 1.00
X0024:Ces5a UTSW 8 93514213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTTCAAGTTCCCAGAGACAC -3'
(R):5'- AGTGGTGGTTTCCAAACAATCC -3'

Sequencing Primer
(F):5'- CAAGCCACCTGTGACTTACAAATTGG -3'
(R):5'- GGTGGTTTCCAAACAATCCTGAAAG -3'
Posted On2016-06-06