Incidental Mutation 'R5072:Oprm1'
ID388891
Institutional Source Beutler Lab
Gene Symbol Oprm1
Ensembl Gene ENSMUSG00000000766
Gene Nameopioid receptor, mu 1
SynonymsOprm, MOP receptor, mor, muOR, MOR-1, MOP-R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location6758506-7038198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6832550 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 398 (S398G)
Ref Sequence ENSEMBL: ENSMUSP00000077704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000783] [ENSMUST00000052751] [ENSMUST00000056385] [ENSMUST00000063036] [ENSMUST00000078634] [ENSMUST00000092729] [ENSMUST00000092731] [ENSMUST00000092734] [ENSMUST00000105597] [ENSMUST00000105601] [ENSMUST00000105602] [ENSMUST00000105603] [ENSMUST00000105604] [ENSMUST00000105605] [ENSMUST00000105607] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000135502] [ENSMUST00000143875] [ENSMUST00000144264] [ENSMUST00000147171] [ENSMUST00000150374] [ENSMUST00000152674] [ENSMUST00000154906] [ENSMUST00000154941]
Predicted Effect probably benign
Transcript: ENSMUST00000000783
SMART Domains Protein: ENSMUSP00000000783
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.3e-10 PFAM
Pfam:7tm_1 85 336 4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052751
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056385
SMART Domains Protein: ENSMUSP00000060590
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078634
AA Change: S398G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077704
Gene: ENSMUSG00000000766
AA Change: S398G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 2.4e-10 PFAM
Pfam:7tm_1 85 336 9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092729
SMART Domains Protein: ENSMUSP00000090405
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092731
SMART Domains Protein: ENSMUSP00000090407
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092734
SMART Domains Protein: ENSMUSP00000090410
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105597
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105602
SMART Domains Protein: ENSMUSP00000101227
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105603
SMART Domains Protein: ENSMUSP00000101228
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 6.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105604
SMART Domains Protein: ENSMUSP00000101229
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 5.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.8e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105605
SMART Domains Protein: ENSMUSP00000101230
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105607
SMART Domains Protein: ENSMUSP00000101232
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105611
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129954
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133486
Predicted Effect probably benign
Transcript: ENSMUST00000135502
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect probably benign
Transcript: ENSMUST00000143875
Predicted Effect probably benign
Transcript: ENSMUST00000144264
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148625
Predicted Effect probably benign
Transcript: ENSMUST00000150374
Predicted Effect probably benign
Transcript: ENSMUST00000152674
SMART Domains Protein: ENSMUSP00000115552
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 94 8e-8 SMART
PDB:4DKL|A 52 94 7e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154906
SMART Domains Protein: ENSMUSP00000114342
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 1.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.1e-10 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mu opioid receptor which is where drugs such as morphine and other opioids have pharmacological effects. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for null mutations exhibit isoform dependent loss of behavioral and gastrointestinal opioid responses and may also show impaired spatial memory, heightened nociception, reduced locomotor activity, increased hematopoietic proliferation, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Oprm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Oprm1 APN 10 7037170 utr 3 prime probably benign
IGL01768:Oprm1 APN 10 6829186 missense probably damaging 1.00
IGL02455:Oprm1 APN 10 6830219 missense probably damaging 1.00
IGL03391:Oprm1 APN 10 7014077 intron probably benign
IGL03410:Oprm1 APN 10 6830051 missense probably damaging 1.00
IGL03048:Oprm1 UTSW 10 6829064 missense probably damaging 1.00
R0189:Oprm1 UTSW 10 6789071 missense possibly damaging 0.94
R0321:Oprm1 UTSW 10 6829183 missense probably damaging 1.00
R0629:Oprm1 UTSW 10 6832604 unclassified probably null
R0730:Oprm1 UTSW 10 6832652 intron probably benign
R1542:Oprm1 UTSW 10 6788960 missense probably damaging 1.00
R1743:Oprm1 UTSW 10 6830105 missense probably damaging 0.99
R1874:Oprm1 UTSW 10 6789035 missense probably benign 0.17
R2864:Oprm1 UTSW 10 6794226 splice site probably null
R2964:Oprm1 UTSW 10 6788914 missense probably damaging 0.98
R3792:Oprm1 UTSW 10 6839544 missense probably benign 0.00
R4008:Oprm1 UTSW 10 6832520 missense probably benign
R4049:Oprm1 UTSW 10 6829087 missense probably benign 0.36
R4088:Oprm1 UTSW 10 6830234 missense probably damaging 1.00
R4724:Oprm1 UTSW 10 6758656 nonsense probably null
R4812:Oprm1 UTSW 10 6832698 intron probably benign
R4822:Oprm1 UTSW 10 6829036 missense probably damaging 0.99
R4855:Oprm1 UTSW 10 6838468 missense probably benign 0.01
R5768:Oprm1 UTSW 10 6789026 missense probably damaging 1.00
R5770:Oprm1 UTSW 10 6789026 missense probably damaging 1.00
R5995:Oprm1 UTSW 10 6832520 missense probably benign
R6327:Oprm1 UTSW 10 6830063 missense probably damaging 0.99
R7135:Oprm1 UTSW 10 6830203 missense possibly damaging 0.77
R7413:Oprm1 UTSW 10 6828919 missense probably damaging 1.00
R7455:Oprm1 UTSW 10 6830204 missense probably damaging 1.00
R8192:Oprm1 UTSW 10 6838417 missense probably benign 0.04
R8210:Oprm1 UTSW 10 6830442 missense probably benign 0.02
X0066:Oprm1 UTSW 10 6830462 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGCTTCCAGCTCAGAAATC -3'
(R):5'- AGAAGGCCCCATGTGTCTTAG -3'

Sequencing Primer
(F):5'- CCAGGCAAAAATGGGTTTCTCTG -3'
(R):5'- CCCATGTGTCTTAGAGGAAGC -3'
Posted On2016-06-06