Mutagenetix > Incidental Mutation

Incidental Mutation 'R5072:Stab2'

388898

Institutional Source

Beutler Lab

Gene Symbol

Stab2

Ensembl Gene

ENSMUSG00000035459

Gene Name

stabilin 2

Synonyms

STAB-2, FEEL-2

Accession Numbers

Genbank: NM_138673; MGI: 2178743

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5072 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86841198-87008025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86863558 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 481 (I481N)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035288]

AlphaFold

Q8R4U0

Predicted Effect

probably benign
Transcript: ENSMUST00000035288
AA Change: I1932N

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: I1932N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EGF	119	156	1.85e0	SMART
EGF	167	201	2.43e1	SMART
EGF	206	244	1.43e-1	SMART
EGF	248	284	3.82e-2	SMART
EGF	333	370	2.02e-1	SMART
FAS1	414	515	1.06e-8	SMART
FAS1	561	662	3.54e-19	SMART
EGF	746	783	6.76e-3	SMART
EGF	836	873	1.31e0	SMART
EGF	877	917	2.99e-4	SMART
EGF	921	960	3.51e-1	SMART
EGF	964	1002	1.99e0	SMART
FAS1	1038	1138	1.73e-13	SMART
FAS1	1181	1276	1.83e-12	SMART
EGF	1354	1391	6.92e0	SMART
EGF	1401	1435	1.11e1	SMART
EGF	1442	1477	3.01e0	SMART
EGF	1481	1519	1.64e-1	SMART
EGF	1523	1561	1.14e0	SMART
EGF	1565	1603	5.62e0	SMART
FAS1	1638	1734	2.23e-25	SMART
FAS1	1785	1891	6.92e-22	SMART
EGF	1966	2006	1.95e1	SMART
EGF_like	1977	2017	2.46e-1	SMART
EGF	2016	2050	1.14e0	SMART
EGF	2058	2089	1.56e1	SMART
EGF	2093	2130	1.36e1	SMART
EGF	2134	2173	2.13e0	SMART
LINK	2204	2298	2.08e-29	SMART
FAS1	2363	2455	3.19e-12	SMART
transmembrane domain	2467	2489	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159445

Predicted Effect

probably benign
Transcript: ENSMUST00000161560
AA Change: I481N

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000125263
Gene: ENSMUSG00000035459
AA Change: I481N

Domain	Start	End	E-Value	Type
EGF	30	68	1.64e-1	SMART
EGF	72	110	1.14e0	SMART
EGF	114	152	5.62e0	SMART
FAS1	187	283	2.23e-25	SMART
FAS1	334	440	6.92e-22	SMART
EGF	515	555	1.95e1	SMART
EGF_like	526	566	2.46e-1	SMART
EGF	565	599	1.14e0	SMART
EGF	607	638	1.56e1	SMART
EGF	643	680	1.36e1	SMART
EGF	684	723	2.13e0	SMART
LINK	754	848	2.08e-29	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000219341
AA Change: I480N

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 95.9%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,853,600	H104Q	probably benign	Het
4933405L10Rik	A	G	8: 105,709,569	T158A	possibly damaging	Het
A1cf	T	C	19: 31,917,985	M156T	probably benign	Het
Abca15	A	G	7: 120,406,975	Y1620C	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox2	A	T	14: 8,241,374	Y579*	probably null	Het
Adnp	A	T	2: 168,183,001	S791R	probably damaging	Het
Agbl1	A	G	7: 76,421,917	E329G	probably damaging	Het
Alx3	G	T	3: 107,604,793	S249I	possibly damaging	Het
Apob	A	G	12: 8,008,714	T2366A	probably benign	Het
Apool	C	T	X: 112,349,843	Q60*	probably null	Het
Arid4a	T	C	12: 71,045,079	V213A	probably benign	Het
Atp7a	A	G	X: 106,109,768	D1092G	probably benign	Het
Bpifa5	A	T	2: 154,165,972	E178V	probably damaging	Het
Car4	G	A	11: 84,963,367	E47K	probably benign	Het
Catsper1	T	C	19: 5,340,046		probably null	Het
Ccdc63	T	A	5: 122,121,055	Q260L	probably benign	Het
Ccdc83	A	T	7: 90,250,529	F45Y	probably damaging	Het
Cct8l1	G	A	5: 25,516,883	V199I	probably benign	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Ces5a	C	T	8: 93,534,668	V44M	probably damaging	Het
Cltc	A	G	11: 86,717,968	I741T	possibly damaging	Het
Cnst	C	A	1: 179,622,886	D638E	possibly damaging	Het
Col13a1	A	G	10: 61,874,018		silent	Het
Cyp2a22	A	T	7: 26,932,481	F450Y	probably benign	Het
Cyp2d10	C	T	15: 82,403,753	R383H	probably benign	Het
Cyp4a29	A	G	4: 115,247,663	T123A	probably benign	Het
Ddx20	A	G	3: 105,682,875		probably null	Het
Dnaja3	A	T	16: 4,696,425	T274S	probably damaging	Het
Dot1l	A	G	10: 80,784,646	D514G	possibly damaging	Het
Dysf	A	T	6: 84,137,272	K1226M	probably damaging	Het
Epha4	T	C	1: 77,445,002	Y281C	probably damaging	Het
Fbxo42	T	C	4: 141,198,945	W313R	probably damaging	Het
Fign	A	T	2: 63,979,693	L411*	probably null	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Fryl	G	A	5: 73,074,767	P1550L	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gprasp2	C	T	X: 135,842,597	T235I	possibly damaging	Het
Gtf2ird1	G	T	5: 134,390,933		probably null	Het
H2afb3	T	C	X: 120,312,846	T84A	probably damaging	Het
Hal	A	T	10: 93,514,042	I555F	probably damaging	Het
Hdac6	A	G	X: 7,944,797	F104L	probably damaging	Homo
Hist2h2ac	C	T	3: 96,220,783		probably benign	Het
Hspg2	T	C	4: 137,540,230	S2050P	probably damaging	Het
Irgc1	T	C	7: 24,432,771	D207G	probably benign	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Kiss1r	C	A	10: 79,918,762	S30*	probably null	Het
Krtap1-4	C	G	11: 99,583,616		probably benign	Het
Lrrfip2	A	G	9: 111,199,804	E365G	probably damaging	Het
Ly75	A	G	2: 60,375,963	Y121H	probably damaging	Het
Man2a1	G	A	17: 64,659,079		probably null	Het
Mkl1	A	G	15: 81,022,426	V91A	probably damaging	Het
Mllt10	C	A	2: 18,109,874	H52N	possibly damaging	Het
Myo1a	T	C	10: 127,707,419		probably null	Het
Myo3b	C	A	2: 70,095,249	T20K	possibly damaging	Het
Nipsnap2	A	T	5: 129,739,580	K62N	probably damaging	Het
Nr1i3	C	T	1: 171,216,813	T169I	probably benign	Het
Numbl	G	A	7: 27,280,990	D466N	probably damaging	Het
Olfr1100	A	T	2: 86,978,322	V158D	possibly damaging	Het
Olfr310	A	G	7: 86,269,591	I66T	probably damaging	Het
Olfr420	A	T	1: 174,158,961	I63F	probably damaging	Het
Olfr639	T	A	7: 104,012,118	R195W	probably damaging	Het
Oprm1	A	G	10: 6,832,550	S398G	probably benign	Het
Pebp1	G	T	5: 117,283,410	D156E	probably benign	Het
Pik3c2g	T	A	6: 139,720,147	C65S	probably null	Het
Pilra	A	G	5: 137,835,412	F131L	probably damaging	Het
Pitrm1	T	C	13: 6,553,190	F91S	probably damaging	Het
Ppl	A	T	16: 5,088,878	S1184R	probably benign	Het
Prmt2	C	T	10: 76,222,556	V140I	probably damaging	Het
Psg29	T	A	7: 17,211,838	D444E	probably damaging	Het
Ptgs1	A	T	2: 36,251,260	N573I	probably damaging	Het
Pygb	C	T	2: 150,801,578	T95M	probably damaging	Het
Rassf9	A	G	10: 102,545,905	K383E	probably damaging	Het
Rfk	T	A	19: 17,398,599	F86I	possibly damaging	Het
Rims2	T	C	15: 39,462,590	F773L	probably benign	Het
Sdcbp	A	G	4: 6,393,019	I218V	probably benign	Het
Slc4a2	G	A	5: 24,438,762	S855N	probably benign	Het
Slc8a2	T	C	7: 16,150,583	L626P	possibly damaging	Het
Snrpd3	G	T	10: 75,519,393	C20F	possibly damaging	Het
Spen	A	T	4: 141,522,302	S58R	unknown	Het
St3gal2	T	C	8: 110,957,718	C3R	possibly damaging	Het
Stat5b	T	C	11: 100,808,535		probably null	Het
Tmco3	G	T	8: 13,292,860	E199*	probably null	Het
Tmem26	A	G	10: 68,775,348	T216A	probably damaging	Het
Ttn	A	G	2: 76,720,478		probably null	Het
Ttn	C	T	2: 76,746,402	V24716I	probably damaging	Het
Ttn	A	T	2: 76,772,365		probably null	Het
Uba5	T	C	9: 104,054,427	E202G	probably damaging	Het
Ufl1	A	G	4: 25,254,780	Y559H	probably benign	Het
Utrn	A	T	10: 12,384,204		probably null	Het
Vmn2r111	C	A	17: 22,548,041	C825F	probably damaging	Het
Vmn2r113	T	A	17: 22,958,355	C704*	probably null	Het
Vmn2r56	A	G	7: 12,694,056	I761T	probably benign	Het
Vmn2r98	C	T	17: 19,066,044	T268I	probably benign	Het
Zfp263	A	G	16: 3,746,840	R240G	possibly damaging	Het
Zfp473	T	A	7: 44,732,519	I797F	probably damaging	Het
Zfp68	A	T	5: 138,606,317	D543E	probably benign	Het

Other mutations in Stab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Stab2	APN	10	86869206	splice site	probably null
IGL00809:Stab2	APN	10	86848174	splice site	probably benign
IGL00911:Stab2	APN	10	86969753	missense	probably damaging	1.00
IGL01347:Stab2	APN	10	86901703	splice site	probably null
IGL01411:Stab2	APN	10	86980008	splice site	probably benign
IGL01503:Stab2	APN	10	86940613	splice site	probably benign
IGL01599:Stab2	APN	10	86922895	missense	probably damaging	1.00
IGL01635:Stab2	APN	10	86981128	missense	probably benign	0.04
IGL01640:Stab2	APN	10	86954171	missense	probably benign	0.09
IGL01671:Stab2	APN	10	86969277	missense	possibly damaging	0.80
IGL02023:Stab2	APN	10	86871831	missense	possibly damaging	0.67
IGL02075:Stab2	APN	10	86967650	missense	possibly damaging	0.71
IGL02174:Stab2	APN	10	86859742	splice site	probably null
IGL02600:Stab2	APN	10	86954259	missense	probably damaging	1.00
IGL02666:Stab2	APN	10	86850902	missense	possibly damaging	0.67
IGL02668:Stab2	APN	10	86846163	splice site	probably benign
IGL02709:Stab2	APN	10	86846165	splice site	probably benign
IGL02728:Stab2	APN	10	86856556	missense	possibly damaging	0.95
IGL02803:Stab2	APN	10	86950269	splice site	probably benign
IGL02938:Stab2	APN	10	86871921	missense	possibly damaging	0.77
IGL03033:Stab2	APN	10	86996803	critical splice donor site	probably null
IGL03238:Stab2	APN	10	86855121	missense	probably damaging	1.00
IGL03402:Stab2	APN	10	86969301	missense	probably benign	0.03
prospector	UTSW	10	86901567	splice site	probably null
songbird	UTSW	10	86858152	missense	probably damaging	1.00
3-1:Stab2	UTSW	10	86869177	missense	probably damaging	0.96
F6893:Stab2	UTSW	10	86855171	missense	probably damaging	1.00
K7371:Stab2	UTSW	10	86943289	critical splice donor site	probably null
PIT4142001:Stab2	UTSW	10	86867175	missense	possibly damaging	0.94
PIT4362001:Stab2	UTSW	10	86861435	nonsense	probably null
R0015:Stab2	UTSW	10	86843617	missense	probably benign
R0254:Stab2	UTSW	10	86897960	missense	probably benign
R0310:Stab2	UTSW	10	86967613	splice site	probably benign
R0333:Stab2	UTSW	10	86841627	missense	probably benign
R0391:Stab2	UTSW	10	86947144	missense	probably benign	0.27
R0400:Stab2	UTSW	10	86872610	missense	probably damaging	1.00
R0433:Stab2	UTSW	10	86843491	splice site	probably benign
R0440:Stab2	UTSW	10	86949928	missense	probably benign	0.23
R0743:Stab2	UTSW	10	86887895	missense	probably damaging	1.00
R0847:Stab2	UTSW	10	86969871	missense	probably benign	0.00
R0883:Stab2	UTSW	10	86924450	splice site	probably benign
R1078:Stab2	UTSW	10	86907133	splice site	probably null
R1118:Stab2	UTSW	10	86885718	splice site	probably null
R1119:Stab2	UTSW	10	86859755	missense	possibly damaging	0.51
R1179:Stab2	UTSW	10	86950301	missense	probably damaging	0.98
R1440:Stab2	UTSW	10	86861367	splice site	probably null
R1550:Stab2	UTSW	10	86878926	missense	probably benign	0.01
R1616:Stab2	UTSW	10	86885718	splice site	probably null
R1728:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1768:Stab2	UTSW	10	87003008	missense	probably damaging	1.00
R1772:Stab2	UTSW	10	86954234	missense	probably benign	0.06
R1776:Stab2	UTSW	10	86957816	missense	possibly damaging	0.92
R1784:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1892:Stab2	UTSW	10	86938049	missense	probably damaging	0.99
R1957:Stab2	UTSW	10	86861470	missense	probably benign	0.13
R1972:Stab2	UTSW	10	86960316	missense	probably damaging	0.99
R1975:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1976:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1996:Stab2	UTSW	10	87003031	missense	probably damaging	1.00
R2085:Stab2	UTSW	10	86954159	missense	probably damaging	1.00
R2149:Stab2	UTSW	10	86865040	nonsense	probably null
R2169:Stab2	UTSW	10	86887862	missense	probably damaging	1.00
R2201:Stab2	UTSW	10	86940639	missense	probably benign	0.22
R2296:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2297:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2298:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2326:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2434:Stab2	UTSW	10	86969319	missense	possibly damaging	0.78
R2519:Stab2	UTSW	10	86934840	splice site	probably benign
R2696:Stab2	UTSW	10	86861499	missense	probably benign	0.45
R2883:Stab2	UTSW	10	86967686	missense	possibly damaging	0.92
R2923:Stab2	UTSW	10	86861461	missense	probably damaging	1.00
R3711:Stab2	UTSW	10	86866708	missense	probably damaging	1.00
R3787:Stab2	UTSW	10	86969277	missense	possibly damaging	0.50
R3834:Stab2	UTSW	10	86949912	missense	possibly damaging	0.87
R3970:Stab2	UTSW	10	86878886	missense	probably damaging	0.97
R3979:Stab2	UTSW	10	86863456	missense	possibly damaging	0.56
R4003:Stab2	UTSW	10	86858124	missense	probably damaging	1.00
R4088:Stab2	UTSW	10	86922185	missense	probably damaging	1.00
R4151:Stab2	UTSW	10	87002983	missense	probably benign	0.12
R4190:Stab2	UTSW	10	86878944	missense	probably damaging	0.98
R4556:Stab2	UTSW	10	86967679	missense	possibly damaging	0.95
R4773:Stab2	UTSW	10	86907371	nonsense	probably null
R4825:Stab2	UTSW	10	86947147	missense	probably benign	0.08
R4865:Stab2	UTSW	10	86843500	splice site	probably null
R4871:Stab2	UTSW	10	86942235	missense	probably damaging	0.99
R4943:Stab2	UTSW	10	86954162	missense	probably damaging	0.99
R4981:Stab2	UTSW	10	86960223	missense	probably benign
R4994:Stab2	UTSW	10	86949907	missense	probably benign
R4999:Stab2	UTSW	10	86937909	missense	probably damaging	0.97
R5061:Stab2	UTSW	10	86907385	missense	probably damaging	1.00
R5073:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5074:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5134:Stab2	UTSW	10	86871810	splice site	probably null
R5213:Stab2	UTSW	10	86907197	missense	probably damaging	0.99
R5508:Stab2	UTSW	10	86960279	missense	probably benign	0.01
R5530:Stab2	UTSW	10	86947162	missense	probably benign	0.04
R5540:Stab2	UTSW	10	86848125	missense	probably benign	0.30
R5839:Stab2	UTSW	10	86872691	missense	probably damaging	0.97
R5949:Stab2	UTSW	10	86969849	missense	possibly damaging	0.87
R6015:Stab2	UTSW	10	86938042	missense	probably damaging	0.99
R6019:Stab2	UTSW	10	87003022	missense	probably benign	0.00
R6116:Stab2	UTSW	10	86907190	missense	probably damaging	1.00
R6131:Stab2	UTSW	10	86883778	splice site	probably null
R6209:Stab2	UTSW	10	86923003	missense	possibly damaging	0.94
R6243:Stab2	UTSW	10	86907161	missense	probably damaging	1.00
R6433:Stab2	UTSW	10	86901567	splice site	probably null
R6787:Stab2	UTSW	10	86919084	missense	probably benign	0.07
R6841:Stab2	UTSW	10	86942190	missense	probably damaging	1.00
R6873:Stab2	UTSW	10	86861366	critical splice donor site	probably null
R7025:Stab2	UTSW	10	86850837	missense	probably damaging	1.00
R7043:Stab2	UTSW	10	86870246	missense	probably damaging	0.99
R7047:Stab2	UTSW	10	86858152	missense	probably damaging	1.00
R7107:Stab2	UTSW	10	86905592	missense	possibly damaging	0.96
R7214:Stab2	UTSW	10	86899841	missense	probably damaging	0.99
R7271:Stab2	UTSW	10	87003108	splice site	probably null
R7291:Stab2	UTSW	10	86946220	missense	probably damaging	0.96
R7336:Stab2	UTSW	10	86969185	nonsense	probably null
R7432:Stab2	UTSW	10	86885683	missense	probably damaging	0.99
R7580:Stab2	UTSW	10	86869164	missense	probably benign	0.00
R7622:Stab2	UTSW	10	86873902	missense	possibly damaging	0.65
R7629:Stab2	UTSW	10	86883782	critical splice donor site	probably null
R7658:Stab2	UTSW	10	86981135	missense	probably benign	0.12
R7798:Stab2	UTSW	10	86957912	missense	probably damaging	0.98
R7835:Stab2	UTSW	10	86872619	missense	probably benign	0.06
R7845:Stab2	UTSW	10	86996894	missense	probably benign	0.09
R7863:Stab2	UTSW	10	86972881	missense	probably benign	0.30
R7885:Stab2	UTSW	10	86878912	missense	probably benign	0.03
R7904:Stab2	UTSW	10	86954192	nonsense	probably null
R7947:Stab2	UTSW	10	86846033	missense	probably benign	0.31
R7963:Stab2	UTSW	10	86848023	critical splice donor site	probably null
R8014:Stab2	UTSW	10	86850903	missense	possibly damaging	0.78
R8021:Stab2	UTSW	10	86905539	missense	possibly damaging	0.69
R8024:Stab2	UTSW	10	86846052	missense	probably benign	0.34
R8097:Stab2	UTSW	10	86869095	missense	possibly damaging	0.86
R8281:Stab2	UTSW	10	86873864	missense	probably damaging	0.98
R8462:Stab2	UTSW	10	86967734	missense	possibly damaging	0.79
R8670:Stab2	UTSW	10	86940723	missense	probably damaging	1.00
R8692:Stab2	UTSW	10	86972930	missense	probably damaging	0.99
R8744:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8745:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8782:Stab2	UTSW	10	86899821	missense	probably benign	0.00
R8875:Stab2	UTSW	10	86996864	missense	probably damaging	1.00
R8978:Stab2	UTSW	10	86949918	missense	possibly damaging	0.64
R9141:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9248:Stab2	UTSW	10	86891617	missense	probably damaging	0.98
R9326:Stab2	UTSW	10	86955146	missense	probably damaging	1.00
R9426:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9568:Stab2	UTSW	10	86863556	missense	probably damaging	1.00
R9627:Stab2	UTSW	10	86957840	missense	probably damaging	0.98
R9635:Stab2	UTSW	10	86850787	nonsense	probably null
R9648:Stab2	UTSW	10	86856697	frame shift	probably null
R9649:Stab2	UTSW	10	86856697	frame shift	probably null
R9650:Stab2	UTSW	10	86856697	frame shift	probably null
R9726:Stab2	UTSW	10	86954231	missense	probably benign	0.00
R9756:Stab2	UTSW	10	86967689	missense	possibly damaging	0.50
R9786:Stab2	UTSW	10	86922133	missense	probably benign	0.03
RF061:Stab2	UTSW	10	86866758	critical splice acceptor site	probably benign
X0023:Stab2	UTSW	10	86922198	critical splice acceptor site	probably null
X0025:Stab2	UTSW	10	86887816	missense	probably damaging	1.00
Z1176:Stab2	UTSW	10	86949914	missense	probably damaging	0.99
Z1177:Stab2	UTSW	10	86896596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAACTGTTCAGTGAGCTGG -3'
(R):5'- AGTTCAGCGTTCCTGGTCTG -3'

Sequencing Primer
(F):5'- GGGTGGAGTTTCCCTACCTC -3'
(R):5'- GCCCATCTACTCCCTTGAAAATC -3'

Posted On

2016-06-06