Incidental Mutation 'R5072:Cltc'
ID388904
Institutional Source Beutler Lab
Gene Symbol Cltc
Ensembl Gene ENSMUSG00000047126
Gene Nameclathrin, heavy polypeptide (Hc)
SynonymsCHC
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86694351-86757565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86717968 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 741 (I741T)
Ref Sequence ENSEMBL: ENSMUSP00000099475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]
Predicted Effect probably benign
Transcript: ENSMUST00000060766
AA Change: I745T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: I745T

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 5.3e-10 PFAM
Pfam:Clathrin_propel 152 191 1.5e-11 PFAM
Pfam:Clathrin_propel 202 238 1.2e-11 PFAM
Pfam:Clathrin_propel 257 292 2.2e-8 PFAM
Pfam:Clathrin_propel 300 334 8.6e-10 PFAM
Pfam:Clathrin-link 335 358 1.7e-17 PFAM
Pfam:Clathrin_H_link 360 425 7.1e-35 PFAM
low complexity region 449 462 N/A INTRINSIC
CLH 541 683 1.65e-41 SMART
CLH 690 832 1.24e-45 SMART
CLH 837 976 6.68e-42 SMART
CLH 983 1128 7.21e-47 SMART
CLH 1132 1273 7.91e-44 SMART
CLH 1278 1424 1.59e-48 SMART
CLH 1427 1586 8.36e-43 SMART
low complexity region 1666 1677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103186
AA Change: I741T

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: I741T

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 2e-7 PFAM
Pfam:Clathrin_propel 148 187 3.8e-9 PFAM
Pfam:Clathrin_propel 198 234 3.8e-9 PFAM
Pfam:Clathrin-link 331 354 3.5e-17 PFAM
Pfam:Clathrin_H_link 356 421 1.9e-35 PFAM
low complexity region 445 458 N/A INTRINSIC
CLH 537 679 1.65e-41 SMART
CLH 686 828 1.24e-45 SMART
CLH 833 972 6.68e-42 SMART
CLH 979 1124 7.21e-47 SMART
CLH 1128 1269 7.91e-44 SMART
CLH 1274 1420 1.59e-48 SMART
CLH 1423 1582 8.36e-43 SMART
low complexity region 1662 1673 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Cltc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Cltc APN 11 86702248 missense probably benign 0.43
IGL01503:Cltc APN 11 86695700 splice site probably benign
IGL01649:Cltc APN 11 86726400 missense probably benign 0.16
IGL01896:Cltc APN 11 86725133 missense probably damaging 1.00
IGL02005:Cltc APN 11 86730219 missense possibly damaging 0.86
IGL02125:Cltc APN 11 86704810 unclassified probably benign
IGL02166:Cltc APN 11 86704088 missense probably benign 0.00
IGL02186:Cltc APN 11 86704985 missense possibly damaging 0.55
IGL02186:Cltc APN 11 86704986 missense possibly damaging 0.55
IGL02214:Cltc APN 11 86732586 missense probably benign 0.08
IGL02227:Cltc APN 11 86697340 missense possibly damaging 0.85
IGL02471:Cltc APN 11 86718034 missense probably damaging 1.00
IGL02607:Cltc APN 11 86706714 missense probably benign 0.00
IGL02888:Cltc APN 11 86757297 utr 5 prime probably benign
IGL03226:Cltc APN 11 86720287 missense probably damaging 1.00
IGL03337:Cltc APN 11 86703683 missense possibly damaging 0.95
Buckey UTSW 11 86720362 missense probably benign 0.01
fuller UTSW 11 86704160 missense possibly damaging 0.79
Geodesic UTSW 11 86733630 missense probably damaging 0.97
R0468:Cltc UTSW 11 86704626 unclassified probably benign
R0487:Cltc UTSW 11 86733664 missense probably damaging 1.00
R0515:Cltc UTSW 11 86709039 missense probably benign 0.25
R0631:Cltc UTSW 11 86712613 missense probably benign 0.03
R0759:Cltc UTSW 11 86737082 missense probably null 0.91
R1635:Cltc UTSW 11 86757279 missense probably benign 0.00
R1671:Cltc UTSW 11 86732595 missense possibly damaging 0.88
R1695:Cltc UTSW 11 86701060 critical splice donor site probably null
R1737:Cltc UTSW 11 86733727 missense probably damaging 1.00
R1747:Cltc UTSW 11 86707081 missense probably damaging 1.00
R1880:Cltc UTSW 11 86712631 missense probably damaging 1.00
R2291:Cltc UTSW 11 86733622 missense probably benign 0.35
R3031:Cltc UTSW 11 86730332 missense probably damaging 1.00
R4012:Cltc UTSW 11 86757261 missense probably benign 0.12
R4022:Cltc UTSW 11 86720348 missense probably damaging 0.96
R4394:Cltc UTSW 11 86733630 missense probably damaging 0.97
R4654:Cltc UTSW 11 86726370 missense probably benign 0.10
R4807:Cltc UTSW 11 86701076 intron probably benign
R4837:Cltc UTSW 11 86695648 missense probably benign 0.00
R4965:Cltc UTSW 11 86707501 missense probably damaging 0.99
R5113:Cltc UTSW 11 86722321 missense probably damaging 0.98
R5126:Cltc UTSW 11 86712669 missense probably damaging 1.00
R5177:Cltc UTSW 11 86705163 missense probably damaging 1.00
R5609:Cltc UTSW 11 86730267 missense probably damaging 0.99
R5610:Cltc UTSW 11 86721646 missense probably benign 0.00
R5677:Cltc UTSW 11 86705242 missense probably damaging 1.00
R5999:Cltc UTSW 11 86704129 missense possibly damaging 0.93
R6197:Cltc UTSW 11 86720362 missense probably benign 0.01
R6198:Cltc UTSW 11 86720362 missense probably benign 0.01
R6264:Cltc UTSW 11 86705258 missense probably damaging 1.00
R6395:Cltc UTSW 11 86725180 missense probably damaging 0.97
R6818:Cltc UTSW 11 86704228 missense possibly damaging 0.86
R6894:Cltc UTSW 11 86712602 nonsense probably null
R7196:Cltc UTSW 11 86706831 missense probably damaging 1.00
R7438:Cltc UTSW 11 86725228 missense probably benign 0.01
R7621:Cltc UTSW 11 86707486 missense probably benign 0.03
R7637:Cltc UTSW 11 86730332 missense probably damaging 1.00
R7729:Cltc UTSW 11 86721648 missense probably benign
R7769:Cltc UTSW 11 86719493 missense probably damaging 1.00
R7817:Cltc UTSW 11 86725123 missense probably damaging 1.00
R7944:Cltc UTSW 11 86737141 missense probably benign 0.01
R7945:Cltc UTSW 11 86737141 missense probably benign 0.01
R8040:Cltc UTSW 11 86725205 missense probably damaging 1.00
R8105:Cltc UTSW 11 86707612 missense probably damaging 0.98
R8203:Cltc UTSW 11 86704160 missense possibly damaging 0.79
R8297:Cltc UTSW 11 86712631 missense probably damaging 1.00
R8304:Cltc UTSW 11 86725261 missense probably benign 0.01
R8419:Cltc UTSW 11 86707566 missense probably benign 0.01
R8673:Cltc UTSW 11 86757375 start gained probably benign
Z1176:Cltc UTSW 11 86702632 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCTTCCTTATTTCTTGAGAAACCACAG -3'
(R):5'- GCTTCACAGTGAGACCTTGTC -3'

Sequencing Primer
(F):5'- CCAGCACAGAATTTGAGAATGC -3'
(R):5'- CACAGTGAGACCTTGTCTTAGAGC -3'
Posted On2016-06-06