Incidental Mutation 'R5072:Arid4a'
ID388909
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene NameAT rich interactive domain 4A (RBP1-like)
SynonymsRbbp1, A630067N03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location71015990-71098592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71045079 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 213 (V213A)
Ref Sequence ENSEMBL: ENSMUSP00000035512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000125125] [ENSMUST00000135709]
Predicted Effect probably benign
Transcript: ENSMUST00000046305
AA Change: V213A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: V213A

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125125
AA Change: V213A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121109
Gene: ENSMUSG00000048118
AA Change: V213A

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 5.53e-10 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 168 263 6e-49 PFAM
low complexity region 267 295 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134718
Predicted Effect probably benign
Transcript: ENSMUST00000135709
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71072593 missense probably damaging 1.00
IGL00546:Arid4a APN 12 71075671 missense probably benign
IGL00553:Arid4a APN 12 71075977 missense probably benign 0.04
IGL00708:Arid4a APN 12 71072728 missense probably benign 0.02
IGL00847:Arid4a APN 12 71075718 missense probably damaging 1.00
IGL01112:Arid4a APN 12 71072733 critical splice donor site probably null
IGL01456:Arid4a APN 12 71067262 missense probably benign 0.00
IGL01505:Arid4a APN 12 71037115 missense probably damaging 1.00
IGL01555:Arid4a APN 12 71061527 splice site probably benign
IGL01631:Arid4a APN 12 71022262 splice site probably benign
IGL02958:Arid4a APN 12 71097563 missense probably benign 0.01
IGL03087:Arid4a APN 12 71075245 missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71039966 missense probably damaging 1.00
IGL03234:Arid4a APN 12 71045060 missense probably benign 0.34
After_8 UTSW 12 71023498 critical splice acceptor site probably null
ariano UTSW 12 71069860 nonsense probably null
guava UTSW 12 71072632 missense probably damaging 0.99
limoncello UTSW 12 71067341 splice site probably null
Sahara UTSW 12 71060115 nonsense probably null
Under_8 UTSW 12 71063206 missense probably benign 0.10
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0270:Arid4a UTSW 12 71072632 missense probably damaging 0.99
R0310:Arid4a UTSW 12 71075830 missense probably benign 0.05
R0504:Arid4a UTSW 12 71047214 missense probably damaging 1.00
R1061:Arid4a UTSW 12 71074955 missense probably damaging 1.00
R1087:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1169:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1171:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1531:Arid4a UTSW 12 71076005 missense probably benign 0.01
R1674:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1676:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1768:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1833:Arid4a UTSW 12 71075466 missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71087589 missense probably damaging 1.00
R2290:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2292:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R3411:Arid4a UTSW 12 71061525 splice site probably benign
R3768:Arid4a UTSW 12 71067119 missense probably damaging 1.00
R3838:Arid4a UTSW 12 71075785 missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71069995 missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71069964 missense probably damaging 1.00
R4829:Arid4a UTSW 12 71023498 critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71075947 missense probably damaging 0.96
R4952:Arid4a UTSW 12 71023525 missense possibly damaging 0.64
R5423:Arid4a UTSW 12 71069860 nonsense probably null
R5767:Arid4a UTSW 12 71060093 missense probably damaging 1.00
R5911:Arid4a UTSW 12 71069973 missense probably damaging 1.00
R5952:Arid4a UTSW 12 71063206 missense probably benign 0.10
R6088:Arid4a UTSW 12 71022236 missense probably damaging 0.99
R6235:Arid4a UTSW 12 71069772 splice site probably null
R6277:Arid4a UTSW 12 71039891 missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71075088 missense probably benign 0.04
R6523:Arid4a UTSW 12 71067341 splice site probably null
R6701:Arid4a UTSW 12 71087512 missense probably damaging 1.00
R6812:Arid4a UTSW 12 71047263 missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71017082 splice site probably null
R6837:Arid4a UTSW 12 71075515 missense probably benign
R6858:Arid4a UTSW 12 71023509 missense probably benign 0.01
R6895:Arid4a UTSW 12 71063302 missense probably benign 0.18
R6901:Arid4a UTSW 12 71067137 missense probably damaging 0.99
R6905:Arid4a UTSW 12 71061544 missense probably benign 0.43
R7387:Arid4a UTSW 12 71087496 missense probably damaging 1.00
R7570:Arid4a UTSW 12 71063142 nonsense probably null
R7772:Arid4a UTSW 12 71061589 missense possibly damaging 0.65
R8194:Arid4a UTSW 12 71060115 nonsense probably null
R8206:Arid4a UTSW 12 71086587 missense probably damaging 1.00
R8552:Arid4a UTSW 12 71060075 missense probably benign
Z1176:Arid4a UTSW 12 71039920 missense possibly damaging 0.89
Z1177:Arid4a UTSW 12 71075637 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAGTCCTTTCCTAACAGATGAAAG -3'
(R):5'- ACAGGTCTTTAATACTGCTGCCAC -3'

Sequencing Primer
(F):5'- CTAACAGATGAAAGTTAGGACGGG -3'
(R):5'- GTCTTTAATACTGCTGCCACTTATTG -3'
Posted On2016-06-06