Incidental Mutation 'R5072:Acox2'
ID388912
Institutional Source Beutler Lab
Gene Symbol Acox2
Ensembl Gene ENSMUSG00000021751
Gene Nameacyl-Coenzyme A oxidase 2, branched chain
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location8225511-8259353 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 8241374 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 579 (Y579*)
Ref Sequence ENSEMBL: ENSMUSP00000126464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000164598]
Predicted Effect probably null
Transcript: ENSMUST00000022271
AA Change: Y579*
SMART Domains Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751
AA Change: Y579*

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 1.2e-28 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 492 677 3.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116361
Predicted Effect probably null
Transcript: ENSMUST00000164598
AA Change: Y579*
SMART Domains Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751
AA Change: Y579*

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 6.3e-29 PFAM
Pfam:Acyl-CoA_dh_M 150 260 2.8e-11 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 495 675 1.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165169
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe mental retardation, and death in children. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice heterozygous for an endonuclease-mediated deletion exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Acox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Acox2 APN 14 8246363 missense probably damaging 1.00
IGL01845:Acox2 APN 14 8251617 missense probably damaging 1.00
IGL02830:Acox2 APN 14 8255298 missense probably damaging 1.00
R0415:Acox2 UTSW 14 8243835 splice site probably benign
R0535:Acox2 UTSW 14 8256753 missense probably damaging 1.00
R1424:Acox2 UTSW 14 8230247 missense probably benign 0.02
R1836:Acox2 UTSW 14 8248059 missense possibly damaging 0.91
R1862:Acox2 UTSW 14 8241416 missense probably benign 0.07
R1885:Acox2 UTSW 14 8248102 missense probably benign 0.00
R2032:Acox2 UTSW 14 8246400 missense probably benign 0.00
R2268:Acox2 UTSW 14 8253496 missense probably damaging 0.98
R2497:Acox2 UTSW 14 8251612 missense probably benign 0.00
R3032:Acox2 UTSW 14 8253466 missense probably damaging 1.00
R3842:Acox2 UTSW 14 8251543 missense probably damaging 1.00
R3874:Acox2 UTSW 14 8248061 missense probably benign 0.00
R4763:Acox2 UTSW 14 8241334 missense possibly damaging 0.81
R5397:Acox2 UTSW 14 8243803 missense probably benign 0.02
R5950:Acox2 UTSW 14 8255793 missense probably benign
R7188:Acox2 UTSW 14 8252996 missense possibly damaging 0.67
R7208:Acox2 UTSW 14 8241303 missense probably benign 0.27
R7315:Acox2 UTSW 14 8256139 missense probably damaging 0.99
R7757:Acox2 UTSW 14 8230166 missense probably damaging 1.00
R7888:Acox2 UTSW 14 8246415 missense probably benign 0.00
R8269:Acox2 UTSW 14 8246325 missense probably benign 0.00
Z1177:Acox2 UTSW 14 8256852 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGGCCCCAAGTTTGCAAGG -3'
(R):5'- GTCCTTGAGGAGACACACATACTC -3'

Sequencing Primer
(F):5'- CCCCAAGTTTGCAAGGTCTTGG -3'
(R):5'- TCCAGCCATCTTGCCAAG -3'
Posted On2016-06-06