Incidental Mutation 'R5072:Dnaja3'
ID388917
Institutional Source Beutler Lab
Gene Symbol Dnaja3
Ensembl Gene ENSMUSG00000004069
Gene NameDnaJ heat shock protein family (Hsp40) member A3
Synonyms1810053A11Rik, 1200003J13Rik, Tid-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5072 (G1)
Quality Score165
Status Not validated
Chromosome16
Chromosomal Location4639989-4707695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4696425 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 274 (T274S)
Ref Sequence ENSEMBL: ENSMUSP00000111520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060067] [ENSMUST00000115854] [ENSMUST00000229529]
Predicted Effect probably damaging
Transcript: ENSMUST00000060067
AA Change: T274S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053842
Gene: ENSMUSG00000004069
AA Change: T274S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
DnaJ 92 150 4.57e-31 SMART
Pfam:DnaJ_C 209 413 4.4e-23 PFAM
Pfam:DnaJ_CXXCXGXG 236 296 2.4e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115854
AA Change: T274S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111520
Gene: ENSMUSG00000004069
AA Change: T274S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
DnaJ 92 150 4.57e-31 SMART
Pfam:DnaJ_CXXCXGXG 236 296 3.9e-14 PFAM
Pfam:CTDII 345 423 1.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138495
Predicted Effect possibly damaging
Transcript: ENSMUST00000229529
AA Change: T223S

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.7213 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ/Hsp40 protein family. DNAJ/Hsp40 proteins stimulate the ATPase activity of Hsp70 chaperones and play critical roles in protein folding, degradation, and multimeric complex assembly. The encoded protein is localized to mitochondria and mediates several cellular processes including proliferation, survival and apoptotic signal transduction. The encoded protein also plays a critical role in tumor suppression through interactions with oncogenic proteins including ErbB2 and the p53 tumor suppressor protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Early embryonic development of homozygous null embryos is disrupted. Blastocysts develop and implant but die afterwards. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Dnaja3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Dnaja3 APN 16 4694445 missense probably damaging 1.00
IGL01531:Dnaja3 APN 16 4694404 missense probably damaging 1.00
IGL01607:Dnaja3 APN 16 4693395 missense probably damaging 1.00
IGL01981:Dnaja3 APN 16 4701169 missense probably damaging 1.00
IGL02312:Dnaja3 APN 16 4694436 missense probably benign 0.02
IGL02473:Dnaja3 APN 16 4701240 nonsense probably null
IGL02795:Dnaja3 APN 16 4690073 splice site probably benign
R1334:Dnaja3 UTSW 16 4699794 missense probably damaging 1.00
R1700:Dnaja3 UTSW 16 4684165 missense probably null 0.02
R1733:Dnaja3 UTSW 16 4684165 missense probably null 0.02
R1854:Dnaja3 UTSW 16 4697269 missense probably damaging 1.00
R2330:Dnaja3 UTSW 16 4690016 missense probably benign 0.01
R4232:Dnaja3 UTSW 16 4699871 missense possibly damaging 0.80
R4357:Dnaja3 UTSW 16 4699867 missense probably damaging 0.96
R4434:Dnaja3 UTSW 16 4689995 nonsense probably null
R5073:Dnaja3 UTSW 16 4696425 missense probably damaging 0.96
R5074:Dnaja3 UTSW 16 4696425 missense probably damaging 0.96
R5160:Dnaja3 UTSW 16 4684288 missense probably benign 0.01
R5174:Dnaja3 UTSW 16 4684297 missense probably benign
R5347:Dnaja3 UTSW 16 4694482 missense possibly damaging 0.78
R7106:Dnaja3 UTSW 16 4705934 missense probably benign 0.13
R7214:Dnaja3 UTSW 16 4701182 missense possibly damaging 0.61
R7673:Dnaja3 UTSW 16 4694464 missense probably benign 0.25
R8069:Dnaja3 UTSW 16 4684267 missense probably benign
R8154:Dnaja3 UTSW 16 4699876 missense possibly damaging 0.53
R8477:Dnaja3 UTSW 16 4687348 missense probably null 0.68
R8811:Dnaja3 UTSW 16 4696519 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TAAATTGTTATTCACACCCGCC -3'
(R):5'- CTGTACAATCATGCATACAACAGGC -3'

Sequencing Primer
(F):5'- GAGTCTCATGTAACCTAGGCTAGC -3'
(R):5'- CACACATGCTAGCCCGTCTG -3'
Posted On2016-06-06