Mutagenetix > Incidental Mutations

Incidental Mutation 'R5073:Tpp2'

388934

Institutional Source

Beutler Lab

Gene Symbol

Tpp2

Ensembl Gene

ENSMUSG00000041763

Gene Name

tripeptidyl peptidase II

Synonyms

TppII

MMRRC Submission

042662-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.615) question?

Stock #

R5073 (G1)

Quality Score

160

Status

Validated

Chromosome

Chromosomal Location

43933647-44003000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 43954736 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 260 (S260R)

Ref Sequence

ENSEMBL: ENSMUSP00000139918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087933
AA Change: S260R

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: S260R

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	35	500	1.4e-96	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	777	964	2.4e-80	PFAM
low complexity region	1017	1033	N/A	INTRINSIC
PDB:3LXU\|X	1034	1262	1e-20	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186028

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188302
AA Change: S260R

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763
AA Change: S260R

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	4.3e-84	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188313
AA Change: S260R

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: S260R

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	5.1e-83	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	966	2.7e-93	PFAM
low complexity region	1004	1020	N/A	INTRINSIC
PDB:3LXU\|X	1021	1249	1e-20	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000189388
AA Change: S260R

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: S260R

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	2.3e-81	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	880	7.8e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190401

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 92.6%

Validation Efficiency

100% (113/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Adcy8	A	T	15: 64,787,358	W528R	probably damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Ahnak	T	A	19: 9,003,231	H626Q	probably benign	Het
Ampd2	A	T	3: 108,079,233	M245K	probably damaging	Het
Apob	G	A	12: 8,005,219		probably null	Het
Apool	C	T	X: 112,349,843	Q60*	probably null	Het
Aqp1	A	T	6: 55,345,535	I172F	probably damaging	Het
Atp7a	A	G	X: 106,109,768	D1092G	probably benign	Het
Bcas3	A	G	11: 85,371,132	Y110C	probably damaging	Het
Brpf1	T	C	6: 113,310,254	S148P	probably damaging	Het
Capn3	A	G	2: 120,491,820	H339R	probably damaging	Het
Ccdc141	A	T	2: 77,124,378		probably null	Het
Ccl2	A	G	11: 82,037,158		probably benign	Het
Cct8l1	G	A	5: 25,516,883	V199I	probably benign	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cit	T	A	5: 115,946,843	M811K	probably benign	Het
Crim1	T	C	17: 78,281,347	C284R	possibly damaging	Het
Cyp2d10	C	T	15: 82,403,753	R383H	probably benign	Het
Cyp4a29	A	G	4: 115,247,663	T123A	probably benign	Het
Dbndd2	A	G	2: 164,490,304		probably benign	Het
Dnaja3	A	T	16: 4,696,425	T274S	probably damaging	Het
Dot1l	A	G	10: 80,784,646	D514G	possibly damaging	Het
Dysf	A	T	6: 84,137,272	K1226M	probably damaging	Het
Eef1akmt1	A	G	14: 57,566,007	L30P	probably damaging	Het
Elavl1	A	G	8: 4,301,741	M125T	possibly damaging	Het
Eml4	C	A	17: 83,463,577	S723R	probably damaging	Het
Fgf15	A	C	7: 144,896,839	Y54S	possibly damaging	Het
Fign	A	T	2: 63,979,693	L411*	probably null	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Fryl	G	A	5: 73,074,767	P1550L	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gprasp2	C	T	X: 135,842,597	T235I	possibly damaging	Het
H2afb3	T	C	X: 120,312,846	T84A	probably damaging	Het
Hal	A	T	10: 93,514,042	I555F	probably damaging	Het
Hdac6	A	G	X: 7,944,797	F104L	probably damaging	Het
Hibadh	C	T	6: 52,620,094	V122M	possibly damaging	Het
Hmga1b	C	T	11: 120,763,186	Q100*	probably null	Het
Hydin	A	G	8: 110,538,473	N2763D	probably benign	Het
Ifi47	A	G	11: 49,095,534	T43A	probably benign	Het
Ifnlr1	A	G	4: 135,705,146	T298A	probably benign	Het
Impdh2	G	A	9: 108,563,336		probably null	Het
Insr	A	G	8: 3,159,475	F1203L	probably damaging	Het
Kcnq4	A	G	4: 120,717,517	S117P	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Kif1a	T	C	1: 93,022,505	H1400R	probably damaging	Het
Kiss1r	C	A	10: 79,918,762	S30*	probably null	Het
Krt222	T	A	11: 99,243,970		probably benign	Het
Lekr1	A	T	3: 65,819,794		noncoding transcript	Het
Ltn1	A	G	16: 87,427,740	V32A	probably damaging	Het
March1	T	A	8: 66,386,368	W21R	probably benign	Het
March5	A	G	19: 37,210,808	N58S	possibly damaging	Het
Mast4	G	A	13: 102,738,883	Q1158*	probably null	Het
Mib2	C	G	4: 155,656,776	A535P	probably damaging	Het
Mkl1	A	G	15: 81,022,426	V91A	probably damaging	Het
Msc	C	T	1: 14,754,313	V178M	probably benign	Het
Muc4	C	A	16: 32,754,529	H1468N	probably benign	Het
Muc5b	A	T	7: 141,859,262	T1982S	unknown	Het
Mvk	A	T	5: 114,452,952		probably benign	Het
Myo1a	T	C	10: 127,707,419		probably null	Het
Myo6	T	G	9: 80,288,008	S887A	probably benign	Het
Myo7a	G	A	7: 98,073,218	Q1167*	probably null	Het
Ncald	A	T	15: 37,397,234	H67Q	probably damaging	Het
Nmnat1	C	A	4: 149,469,138	M172I	probably benign	Het
Nudt1	G	T	5: 140,331,907		probably null	Het
Nudt5	T	A	2: 5,864,387	H141Q	probably benign	Het
Olfr1100	A	T	2: 86,978,322	V158D	possibly damaging	Het
Olfr1508	T	A	14: 52,463,575	M118L	probably damaging	Het
Olfr24	T	C	9: 18,754,822	E271G	possibly damaging	Het
Parp14	A	T	16: 35,834,707	I1798K	probably damaging	Het
Pcdhga7	A	G	18: 37,715,972	D344G	probably damaging	Het
Pck1	A	G	2: 173,156,977	T343A	probably benign	Het
Pik3c2g	T	A	6: 139,720,147	C65S	probably null	Het
Pilra	A	G	5: 137,835,412	F131L	probably damaging	Het
Ppl	A	T	16: 5,088,878	S1184R	probably benign	Het
Prmt2	C	T	10: 76,222,556	V140I	probably damaging	Het
Prpf38b	A	G	3: 108,911,168	F92S	probably damaging	Het
Psmc3	A	G	2: 91,054,570		probably benign	Het
Ptgs1	A	T	2: 36,251,260	N573I	probably damaging	Het
Rgs9	C	A	11: 109,227,331	A332S	probably benign	Het
Rptor	T	C	11: 119,896,479	I1290T	possibly damaging	Het
Slc38a7	C	A	8: 95,841,650	R369L	probably damaging	Het
Slc4a2	G	A	5: 24,438,762	S855N	probably benign	Het
Slco2a1	G	T	9: 103,046,726	L46F	probably damaging	Het
Snrpd3	G	T	10: 75,519,393	C20F	possibly damaging	Het
Stab2	A	T	10: 86,863,558	I481N	probably benign	Het
Tbc1d9	A	G	8: 83,233,547	E143G	probably damaging	Het
Tenm2	T	A	11: 36,068,381	T1114S	probably damaging	Het
Tg	A	C	15: 66,735,252	M213L	probably benign	Het
Tnc	A	G	4: 64,020,411	C64R	probably damaging	Het
Tpd52l1	A	G	10: 31,357,920	L79S	probably damaging	Het
Tppp2	G	A	14: 51,920,455	R119Q	probably benign	Het
Tshz2	A	T	2: 169,962,573		probably benign	Het
Tuba8	T	C	6: 121,222,903	V182A	probably damaging	Het
Ufl1	A	G	4: 25,254,780	Y559H	probably benign	Het
Usp53	A	T	3: 122,933,946	S996T	probably benign	Het
Vcam1	A	G	3: 116,124,388	V308A	probably damaging	Het
Wdr17	T	A	8: 54,690,236		probably null	Het
Wdr6	G	A	9: 108,574,366	H773Y	probably damaging	Het
Wnk4	T	G	11: 101,261,188	F173V	probably damaging	Het
Xrcc5	T	C	1: 72,339,029	Y395H	probably damaging	Het
Zcwpw1	T	A	5: 137,795,519	M1K	probably null	Het
Zfp263	A	G	16: 3,746,840	R240G	possibly damaging	Het
Zfp652	A	G	11: 95,750,064	I272V	possibly damaging	Het

Other mutations in Tpp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Tpp2	APN	1	43983291	missense	possibly damaging	0.90
IGL01021:Tpp2	APN	1	43934187	nonsense	probably null
IGL01096:Tpp2	APN	1	43960888	missense	probably damaging	1.00
IGL01344:Tpp2	APN	1	43983262	missense	probably benign	0.04
IGL01642:Tpp2	APN	1	43954653	missense	probably damaging	1.00
IGL02719:Tpp2	APN	1	43940231	missense	probably benign	0.09
IGL02890:Tpp2	APN	1	43999690	missense	probably damaging	1.00
IGL03102:Tpp2	APN	1	43956489	missense	probably damaging	1.00
IGL03175:Tpp2	APN	1	43973511	missense	probably benign	0.35
beaver	UTSW	1	43971715	missense	probably benign	0.08
billingsly	UTSW	1	43983552	missense	probably damaging	1.00
cleaver	UTSW	1	43978508	nonsense	probably null
Eddie	UTSW	1	43968988	missense	probably damaging	1.00
June	UTSW	1	43954710	missense	probably damaging	1.00
mathers	UTSW	1	43992268	missense	probably damaging	1.00
state	UTSW	1	43978438	missense	possibly damaging	0.48
wally	UTSW	1	43992396	critical splice donor site	probably null
Ward	UTSW	1	43954736	missense	possibly damaging	0.82
BB010:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
BB020:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R0001:Tpp2	UTSW	1	43971726	missense	probably benign	0.00
R0003:Tpp2	UTSW	1	43960139	missense	possibly damaging	0.94
R0066:Tpp2	UTSW	1	43981748	missense	possibly damaging	0.56
R0110:Tpp2	UTSW	1	43999693	missense	probably damaging	1.00
R0110:Tpp2	UTSW	1	43978504	missense	probably benign	0.00
R0167:Tpp2	UTSW	1	43970488	missense	probably benign	0.01
R0441:Tpp2	UTSW	1	43990562	missense	possibly damaging	0.85
R0520:Tpp2	UTSW	1	43990530	missense	probably damaging	1.00
R0639:Tpp2	UTSW	1	43975447	missense	probably benign	0.00
R1118:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1119:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1593:Tpp2	UTSW	1	43975433	missense	probably benign	0.01
R1702:Tpp2	UTSW	1	43990548	missense	probably damaging	0.99
R1756:Tpp2	UTSW	1	43978725	splice site	probably null
R2066:Tpp2	UTSW	1	43978438	missense	possibly damaging	0.48
R2171:Tpp2	UTSW	1	43957446	missense	probably benign	0.00
R2378:Tpp2	UTSW	1	43999765	missense	probably damaging	0.99
R2394:Tpp2	UTSW	1	43983186	missense	possibly damaging	0.83
R2507:Tpp2	UTSW	1	44001449	missense	probably benign	0.31
R2879:Tpp2	UTSW	1	43971623	missense	probably damaging	1.00
R3436:Tpp2	UTSW	1	43940144	missense	probably damaging	0.99
R4106:Tpp2	UTSW	1	44001457	missense	possibly damaging	0.71
R4658:Tpp2	UTSW	1	43954710	missense	probably damaging	1.00
R4760:Tpp2	UTSW	1	43971715	missense	probably benign	0.08
R4963:Tpp2	UTSW	1	43992268	missense	probably damaging	1.00
R5049:Tpp2	UTSW	1	44001473	missense	possibly damaging	0.46
R6010:Tpp2	UTSW	1	43951213	critical splice donor site	probably null
R6118:Tpp2	UTSW	1	43940146	missense	probably damaging	1.00
R6155:Tpp2	UTSW	1	43956489	missense	probably damaging	1.00
R6169:Tpp2	UTSW	1	43983579	missense	probably damaging	0.99
R6236:Tpp2	UTSW	1	43977317	missense	probably benign	0.01
R6695:Tpp2	UTSW	1	43983276	missense	probably benign
R6845:Tpp2	UTSW	1	43978508	nonsense	probably null
R7054:Tpp2	UTSW	1	43983158	missense	probably damaging	1.00
R7094:Tpp2	UTSW	1	43968988	missense	probably damaging	1.00
R7223:Tpp2	UTSW	1	43968888	missense	probably damaging	1.00
R7316:Tpp2	UTSW	1	43970431	missense	probably benign	0.00
R7324:Tpp2	UTSW	1	43978778	missense	probably damaging	1.00
R7363:Tpp2	UTSW	1	43985422	missense	probably benign	0.00
R7454:Tpp2	UTSW	1	43954659	missense	probably benign	0.01
R7496:Tpp2	UTSW	1	43983517	missense	probably benign	0.09
R7699:Tpp2	UTSW	1	43970466	missense	probably benign
R7700:Tpp2	UTSW	1	43970466	missense	probably benign
R7804:Tpp2	UTSW	1	43983281	missense	probably benign	0.00
R7933:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R7979:Tpp2	UTSW	1	43940137	missense	probably benign	0.35
R8032:Tpp2	UTSW	1	43975468	missense	possibly damaging	0.82
R8101:Tpp2	UTSW	1	43970440	missense	probably damaging	1.00
R8245:Tpp2	UTSW	1	43983552	missense	probably damaging	1.00
R8314:Tpp2	UTSW	1	43934227	missense	probably benign	0.10
R8518:Tpp2	UTSW	1	43980385	missense	probably damaging	1.00
R8519:Tpp2	UTSW	1	43977205	critical splice acceptor site	probably null
R8529:Tpp2	UTSW	1	43983140	missense	probably benign
R8756:Tpp2	UTSW	1	43960135	nonsense	probably null
R8765:Tpp2	UTSW	1	43972689	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGTGGGAGGATAAATTTTAATGCC -3'
(R):5'- CCACAGTTAGGGTTGAATTTCTC -3'

Sequencing Primer
(F):5'- ATGCCTATTTCTCCTTCCCAACAGAG -3'
(R):5'- CAGTTAGGGTTGAATTTCTCAAAGG -3'

Posted On

2016-06-06